Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX364285.2
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX364285.2, 898 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|46554193|gb|BX364285.2|BX364285 BX364285 Homo sapiens B CELLS (RAMOS CELL LINE) COT 25-NORMALIZED Homo sapiens cDNA clone CS0DL011YP21 5-PRIME, mRNA sequence
>ENSG00000101017

1-95  (34-128)   98% ->
96-174  (3554-3632)   100% ->
175-300  (3967-4092)   100% ->
301-447  (4344-4490)   100% ->
448-541  (4860-4953)   100% ->
542-643  (8374-8475)   100% ->
644-728  (9872-9958)   96% ->
729-756  (10064-10092)   96% ->
757-866  (10616-10726)   93%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCCATGGTT
        ||||||||||||||||||||||||||||||||||||||||||| ||||||
     34 TCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTT

     50     .    :    .    :    .    :    .    :    .    :
     51 CGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
     84 CGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG..

    100     .    :    .    :    .    :    .    :    .    :
     96     GTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAA
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
    134 .TAGGTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAA

    150     .    :    .    :    .    :    .    :    .    :
    142 TAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG         GACAGAAA
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
   3600 TAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG...CAGGACAGAAA

    200     .    :    .    :    .    :    .    :    .    :
    183 CTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3975 CTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGG

    250     .    :    .    :    .    :    .    :    .    :
    233 TGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4025 TGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGC

    300     .    :    .    :    .    :    .    :    .    :
    283 ACAAATACTGCGACCCCA         ACCTAGGGCTTCGGGTCCAGCAG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
   4075 ACAAATACTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAGCAG

    350     .    :    .    :    .    :    .    :    .    :
    324 AAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4367 AAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCA

    400     .    :    .    :    .    :    .    :    .    :
    374 CTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4417 CTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGC

    450     .    :    .    :    .    :    .    :    .    :
    424 CCGGCTTTGGGGTCAAGCAGATTG         CTACAGGGGTTTCTGAT
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
   4467 CCGGCTTTGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTGAT

    500     .    :    .    :    .    :    .    :    .    :
    465 ACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4877 ACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGC

    550     .    :    .    :    .    :    .    :    .    :
    515 TTTCGAAAAATGTCACCCTTGGACAAG         CTGTGAGACCAAAG
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
   4927 TTTCGAAAAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCAAAG

    600     .    :    .    :    .    :    .    :    .    :
    556 ACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   8388 ACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTGGT

    650     .    :    .    :    .    :    .    :    .    :
    606 GAGTCCTGGACAATGGGCCCTGGAGAAAGCCTAGGAAG         GTC
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
   8438 GAGTCCTGGACAATGGGCCCTGGAGAAAGCCTAGGAAGGTG...CAGGTC

    700     .    :    .    :    .    :    .    :    .    :
    647 CCCAGGATCGGCTGAGAG CCTGGTGGTG TYCCCATCATCTTCGGGATC
        ||||||||||||||||||-||||||||||-| ||||||||||||||||||
   9875 CCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATC

    750     .    :    .    :    .    :    .    :    .    :
    695 CTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCA         AAAAGGT
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
   9925 CTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCAGTG...TAGAAAAGGT

    800     .    :    .    :    .    :    .    :    .    :
    736 GGCCAAGAAGC AACCAATAAG         GCCCCCCACCCCAAGCAGG
        |||||||||||-||||||||||>>>...>>>|||||||||||||||||||
  10071 GGCCAAGAAGCCAACCAATAAGGTA...CAGGCCCCCCACCCCAAGCAGG

    850     .    :    .    :    .    :    .    :    .    :
    776 AACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGGCTCCAACACTGCC
        |||||||||||||||||||||||||||||||||||||||||||||||||-
  10635 AACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGGCTCCAACACTGC 

    900     .    :    .    :    .    :    .    :
    826 TGC CCAGTGCAGGAGACTTTACATKGATKCC AMCGGGCACC
        |||-||||||||||||||||||||| ||| ||-| ||| ||||
  10684 TGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGTCACC

END