Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX381481.2
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX381481.2, 1041 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|46571664|gb|BX381481.2|BX381481 BX381481 Homo sapiens PLACENTA COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI066YM17 5-PRIME, mRNA sequence
>ENSG00000101017

1-97  (32-128)   98% ->
98-176  (3554-3632)   100% ->
177-302  (3967-4092)   100% ->
303-449  (4344-4490)   100% ->
450-543  (4860-4953)   100% ->
544-605  (8374-8435)   100% ->
606-692  (9872-9958)   100% ->
693-721  (10064-10092)   100% ->
722-953  (10616-10852)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCCATGG
        ||||||||||||||||||||||||||||||||||||||||||||| ||||
     32 CCTCGCTCGGGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGG

     50     .    :    .    :    .    :    .    :    .    :
     51 TTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
     82 TTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG

    100     .    :    .    :    .    :    .    :    .    :
     98       GTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCT
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
    132 ...TAGGTCCATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCT

    150     .    :    .    :    .    :    .    :    .    :
    142 AATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAG         GACAGA
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
   3598 AATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGTG...CAGGACAGA

    200     .    :    .    :    .    :    .    :    .    :
    183 AACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3973 AACTGGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGC

    250     .    :    .    :    .    :    .    :    .    :
    233 GGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4023 GGTGAAAGCGAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCA

    300     .    :    .    :    .    :    .    :    .    :
    283 GCACAAATACTGCGACCCCA         ACCTAGGGCTTCGGGTCCAGC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
   4073 GCACAAATACTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAGC

    350     .    :    .    :    .    :    .    :    .    :
    324 AGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4365 AGAAGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGG

    400     .    :    .    :    .    :    .    :    .    :
    374 CACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4415 CACTGTACGAGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTC

    450     .    :    .    :    .    :    .    :    .    :
    424 GCCCGGCTTTGGGGTCAAGCAGATTG         CTACAGGGGTTTCTG
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
   4465 GCCCGGCTTTGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTG

    500     .    :    .    :    .    :    .    :    .    :
    465 ATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4875 ATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCT

    550     .    :    .    :    .    :    .    :    .    :
    515 GCTTTCGAAAAATGTCACCCTTGGACAAG         CTGTGAGACCAA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
   4925 GCTTTCGAAAAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCAA

    600     .    :    .    :    .    :    .    :    .    :
    556 AGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   8386 AGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG

    650     .    :    .    :    .    :    .    :    .    :
    606          GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
   8436 GTG...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATC

    700     .    :    .    :    .    :    .    :    .    :
    647 ATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCA    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
   9913 ATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCAGTG.

    750     .    :    .    :    .    :    .    :    .    :
    693      AAAAGGTGGCCAAGAAGCCAACCAATAAG         GCCCCCC
        ..>>>|||||||||||||||||||||||||||||>>>...>>>|||||||
   9963 ..TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA...CAGGCCCCCC

    800     .    :    .    :    .    :    .    :    .    :
    729 ACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10623 ACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGATCTTCCTGGC

    850     .    :    .    :    .    :    .    :    .    :
    779 TCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10673 TCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGCCAACCGGT

    900     .    :    .    :    .    :    .    :    .    :
    829 CACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGAGAGACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10723 CACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGAGAGACAGT

    950     .    :    .    :    .    :    .    :    .    :
    879 GAGGCTGCACCCACCCAGGAGTGTGGC ACGTGGGCAAACAGGCAGTTGG
        |||||||||||||||||||||||||||-||||||||||||||||||||||
  10773 GAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAACAGGCAGTTGG

   1000     .    :    .    :    .    :
    928 C AGAGAGC TTGTG TGCTG TGCTGTGG
        |-|||||||-| |||-|||||-||||||||
  10823 CCAGAGAGCCTGGTGCTGCTGCTGCTGTGG

END