Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX387737.2
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX387737.2, 552 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|46875052|gb|BX387737.2|BX387737 BX387737 Homo sapiens PLACENTA COT 25-NORMALIZED Homo sapiens cDNA clone CS0DI049YD01 5-PRIME, mRNA sequence
>ENSG00000140443

1-47  (263687-263733)   89% ->
48-215  (266415-266582)   89% ->
216-420  (267123-267327)   100% ->
421-552  (272599-272730)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCG GGATGCCAAGAGTGAGATCTTGTACATTCGCACCAATSCTTCAS  
        |||-|| -||||||||||||||||||||||||||||||||| ||||| >>
 263687 CCGTGGG GCCAAGAGTGAGATCTTGTACATTCGCACCAATGCTTCAGGT

     50     .    :    .    :    .    :    .    :    .    :
     48        TYCCTTCCATTCCCTTGGNCGTBCTTBCCSCCYCSSNCYCCTC
        >...>>>| |||||||||||||||| ||| ||| |  |  |   | ||||
 263736 A...CAGTTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCGAACTCCTC

    100     .    :    .    :    .    :    .    :    .    :
     91 TBCYCAGTCAAYCGTGAANTGGAACCCTCCCTCTCTGCCCAACGGCAACC
        | | |||| || |||||| |||||||||||||||||||||||||||||||
 266458 TTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACGGCAACC

    150     .    :    .    :    .    :    .    :    .    :
    141 TGAGTDACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTT
        ||||| ||||||||||||||||||||||||||||||||||||||||||||
 266508 TGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTT

    200     .    :    .    :    .    :    .    :    .    :
    191 TACCGGCACAATTACTGCTCCAAAG         ACAAAATCCCCATCAG
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 266558 TACCGGCACAATTACTGCTCCAAAGGTA...AAGACAAAATCCCCATCAG

    250     .    :    .    :    .    :    .    :    .    :
    232 GAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267139 GAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCA

    300     .    :    .    :    .    :    .    :    .    :
    282 AGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267189 AGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAA

    350     .    :    .    :    .    :    .    :    .    :
    332 ACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267239 ACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGT

    400     .    :    .    :    .    :    .    :    .    :
    382 CTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAG         AC
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 267289 CTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAGGTA...CAGAC

    450     .    :    .    :    .    :    .    :    .    :
    423 CTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272601 CTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCC

    500     .    :    .    :    .    :    .    :    .    :
    473 AGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCACTGACCC
        |||||||||||||||||||||||||||||||||||||||||||| |||||
 272651 AGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCACCGACCC

    550     .    :    .    :    .    :
    523 GGAAGAGCTGGAGACAGAGTACCCTTTCTT
        ||||||||||||||||||||||||||||||
 272701 GGAAGAGCTGGAGACAGAGTACCCTTTCTT

END