Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX471806.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX471806.1, 383 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|31666099|gb|BX471806.1|BX471806 DKFZp686J16129_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686J16129 5', mRNA sequence
>ENSG00000140443

1-52  (263682-263733)   94% ->
53-220  (266415-266582)   100% ->
221-383  (267123-267285)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGGATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGCACCAATGCTTC
           |||||||||||||||||||||||||||||||||||||||||||||||
 263682 CATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGCACCAATGCTTC

     50     .    :    .    :    .    :    .    :    .    :
     51 AG         TTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCGAACT
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 263732 AGGTA...CAGTTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCGAACT

    100     .    :    .    :    .    :    .    :    .    :
     92 CCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266454 CCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACGGC

    150     .    :    .    :    .    :    .    :    .    :
    142 AACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266504 AACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTA

    200     .    :    .    :    .    :    .    :    .    :
    192 CCTTTACCGGCACAATTACTGCTCCAAAG         ACAAAATCCCCA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 266554 CCTTTACCGGCACAATTACTGCTCCAAAGGTA...AAGACAAAATCCCCA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267135 TCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGAAC

    300     .    :    .    :    .    :    .    :    .    :
    283 CCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267185 CCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCC

    350     .    :    .    :    .    :    .    :    .    :
    333 CAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267235 CAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCA

    400 
    383 A
        |
 267285 A

END