Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX486886.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX486886.1, 464 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|31950994|gb|BX486886.1|BX486886 DKFZp686O14253_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686O14253 5', mRNA sequence
>ENSG00000001626

1-33  (112663-112695)   100% ->
34-162  (114968-115096)   99% ->
163-200  (122864-122901)   100% ->
201-453  (123570-123822)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAAGTGAAGAAATTAACGAAGAAGACTTAAAG         GAGTGCTT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 112663 ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGTA...CAGGAGTGCTT

     50     .    :    .    :    .    :    .    :    .    :
     42 TTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 114976 TTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACC

    100     .    :    .    :    .    :    .    :    .    :
     92 TTCGATATATTACGGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGC
        ||||||||||||| ||||||||||||||||||||||||||||||||||||
 115026 TTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGC

    150     .    :    .    :    .    :    .    :    .    :
    142 TTAGTAATTTTTCTGGCAGAG         GTGGCTGCTTCTTTGGTTGT
        |||||||||||||||||||||>>>...>>>||||||||||||||||||||
 115076 TTAGTAATTTTTCTGGCAGAGGTA...CAGGTGGCTGCTTCTTTGGTTGT

    200     .    :    .    :    .    :    .    :    .    :
    183 GCTGTGGCTCCTTGGAAA         CACTCCTCTTCAAGACAAAGGGA
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
 122884 GCTGTGGCTCCTTGGAAAGTG...CAGCACTCCTCTTCAAGACAAAGGGA

    250     .    :    .    :    .    :    .    :    .    :
    224 ATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123593 ATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACC

    300     .    :    .    :    .    :    .    :    .    :
    274 AGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123643 AGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCT

    350     .    :    .    :    .    :    .    :    .    :
    324 TGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123693 TGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAG

    400     .    :    .    :    .    :    .    :    .    :
    374 TGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123743 TGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT

    450     .    :    .    :    .    :
    424 ATGTCAACCCTCAACACGTTGAAAGCAGGT
        ||||||||||||||||||||||||||||||
 123793 ATGTCAACCCTCAACACGTTGAAAGCAGGT

END