Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX492365.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX492365.1, 580 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|32003729|gb|BX492365.1|BX492365 DKFZp781I0819_r1 781 (synonym: hlcc4) Homo sapiens cDNA clone DKFZp781I0819 5', mRNA sequence
>ENSG00000140443

1-378  (58181-58558)   100% ->
379-580  (241776-241976)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58181 TCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTCACG

     50     .    :    .    :    .    :    .    :    .    :
     51 GTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58231 GTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTTCGA

    100     .    :    .    :    .    :    .    :    .    :
    101 GATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58281 GATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTACTC

    150     .    :    .    :    .    :    .    :    .    :
    151 GGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58331 GGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCACT

    200     .    :    .    :    .    :    .    :    .    :
    201 GTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58381 GTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGTGGG

    250     .    :    .    :    .    :    .    :    .    :
    251 GAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58431 GAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGGAGG

    300     .    :    .    :    .    :    .    :    .    :
    301 AGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTACCGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58481 AGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTACCGC

    350     .    :    .    :    .    :    .    :    .    :
    351 TGCTGGACCACAAACCGCTGCCAGAAAA         TGTGCCCAAGCAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  58531 TGCTGGACCACAAACCGCTGCCAGAAAAGTA...CAGTGTGCCCAAGCAC

    400     .    :    .    :    .    :    .    :    .    :
    392 GTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241789 GTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCGAGT

    450     .    :    .    :    .    :    .    :    .    :
    442 GCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241839 GCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCTTGC

    500     .    :    .    :    .    :    .    :    .    :
    492 CGCCACTACTACTATTGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAACA
        |||||||||||||||-||||||||||||||||||||||||||||||||||
 241889 CGCCACTACTACTAT GCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAACA

    550     .    :    .    :    .    :    .
    542 CCCACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACT
        || ||||||||||||||||||||||||||||||||||||
 241938 CCTACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACT

END