Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX497680.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX497680.1, 466 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|32014522|gb|BX497680.1|BX497680 DKFZp779B1735_r1 779 (synonym: hncc1) Homo sapiens cDNA clone DKFZp779B1735 5', mRNA sequence
>ENSG00000001626

1-127  (130581-130707)   99% ->
128-355  (131619-131846)   99% ->
356-465  (134651-134759)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATAGCAGTGGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCC
        |||||||| |||||||||||||||||||||||||||||||||||||||||
 130581 ATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCC

     50     .    :    .    :    .    :    .    :    .    :
     51 AGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 130631 AGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCAC

    100     .    :    .    :    .    :    .    :    .    :
    101 AGCAACTCAAACAACTGGAATCTGAAG         GCAGGAGTCCAATT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 130681 AGCAACTCAAACAACTGGAATCTGAAGGTA...CAGGCAGGAGTCCAATT

    150     .    :    .    :    .    :    .    :    .    :
    142 TTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTGCCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131633 TTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTGCCTT

    200     .    :    .    :    .    :    .    :    .    :
    192 CGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131683 CGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTAC

    250     .    :    .    :    .    :    .    :    .    :
    242 ATACTGCCAACTGGTTCTTGCACCTGTCAACACTGCGCTGGTTCCAAATG
        |||||||||||||||||||| |||||||||||||||||||||||||||||
 131733 ATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATG

    300     .    :    .    :    .    :    .    :    .    :
    292 AGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131783 AGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTC

    350     .    :    .    :    .    :    .    :    .    :
    342 CATTTTAACAACAG         GAGAAGGAGAAGGAAGAGTTGGTATTA
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 131833 CATTTTAACAACAGGTA...TAGGAGAAGGAGAAGGAAGAGTTGGTATTA

    400     .    :    .    :    .    :    .    :    .    :
    383 TCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCTGTAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134678 TCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCTGTAAAC

    450     .    :    .    :    .    :
    433 TCCAGCATAGGTGTGGATAGCTTGATGCGATCT
        |||||||||| ||||||||||||| |  |-|||
 134728 TCCAGCATAGATGTGGATAGCTTGGTAAG TCT

END