Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX499036.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX499036.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|32017119|gb|BX499036.1|BX499036 DKFZp779D0243_r1 779 (synonym: hncc1) Homo sapiens cDNA clone DKFZp779D0243 5', mRNA sequence
>ENSG00000001626

1-163  (147645-147808)   98% ->
164-319  (162476-162631)   99% ->
320-409  (172880-172969)   100% ->
410-582  (184726-184898)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCAACTCTCGAAAGTTATGATTATTGAGAA TCACACGTGAAGAAAGAT
        |||||||||||||||||||||||||||||||-||||||||||||||||||
 147645 GCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGAT

     50     .    :    .    :    .    :    .    :    .    :
     50 GACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCGCAGCAAA
        |||||||||||||||||||||||||||||||||||||||||| |||||||
 147695 GACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAA

    100     .    :    .    :    .    :    .    :    .    :
    100 ATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 147745 ATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAA

    150     .    :    .    :    .    :    .    :    .    :
    150 GTCCTGGCCAGAGG         GTGGGCCTCTTGGGAAGAACTGGATCA
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 147795 GTCCTGGCCAGAGGGTG...TAGGTGGGCCTCTTGGGAAGAACTGGATCA

    200     .    :    .    :    .    :    .    :    .    :
    191 GGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162503 GGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGG

    250     .    :    .    :    .    :    .    :    .    :
    241 AGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162553 AGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGT

    300     .    :    .    :    .    :    .    :    .    :
    291 GGAGGAAAGCCTTTGGAGTGATACCGCAG         AAAGTATTTATT
        ||||||||||||||||||||||||| |||>>>...>>>||||||||||||
 162603 GGAGGAAAGCCTTTGGAGTGATACCACAGGTG...TAGAAAGTATTTATT

    350     .    :    .    :    .    :    .    :    .    :
    332 TTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 172892 TTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGA

    400     .    :    .    :    .    :    .    :    .    :
    382 TCAAGAAATATGGAAAGTTGCAGATGAG         GTTGGGCTCAGAT
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 172942 TCAAGAAATATGGAAAGTTGCAGATGAGGTA...CAGGTTGGGCTCAGAT

    450     .    :    .    :    .    :    .    :    .    :
    423 CTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184739 CTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGG

    500     .    :    .    :    .    :    .    :    .    :
    473 GGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGACGTGCTTGGCTAGATC
        |||||||||||||||||||||||||||||||||| |||||||||||||||
 184789 GGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATC

    550     .    :    .    :    .    :    .    :    .    :
    523 TGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATN
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
 184839 TGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATT

    600     .    :
    573 TGGATCCAGT
        ||||||||||
 184889 TGGATCCAGT

END