Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX506791.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX506791.1, 609 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|32047382|gb|BX506791.1|BX506791 DKFZp779J031_r1 779 (synonym: hncc1) Homo sapiens cDNA clone DKFZp779J031 5', mRNA sequence
>ENSG00000001626

1-29  (162603-162631)   100% ->
30-119  (172880-172969)   100% ->
120-292  (184726-184898)   99% ->
293-398  (185497-185602)   100% ->
399-609  (186946-187156)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGAGGAAAGCCTTTGGAGTGATACCACAG         AAAGTATTTATT
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 162603 GGAGGAAAGCCTTTGGAGTGATACCACAGGTG...TAGAAAGTATTTATT

     50     .    :    .    :    .    :    .    :    .    :
     42 TTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 172892 TTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGA

    100     .    :    .    :    .    :    .    :    .    :
     92 TCAAGAAATATGGAAAGTTGCAGATGAG         GTTGGGCTCAGAT
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
 172942 TCAAGAAATATGGAAAGTTGCAGATGAGGTA...CAGGTTGGGCTCAGAT

    150     .    :    .    :    .    :    .    :    .    :
    133 CTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184739 CTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGG

    200     .    :    .    :    .    :    .    :    .    :
    183 GGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184789 GGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATC

    250     .    :    .    :    .    :    .    :    .    :
    233 TGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGACGAACCCAGTGCTCATT
        ||||||||||||||||||||||||||||||||| ||||||||||||||||
 184839 TGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATT

    300     .    :    .    :    .    :    .    :    .    :
    283 TGGATCCAGT         AACATACCAAATAATTAGAAGAACTCTAAAA
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 184889 TGGATCCAGTGTG...TAGAACATACCAAATAATTAGAAGAACTCTAAAA

    350     .    :    .    :    .    :    .    :    .    :
    324 CAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 185528 CAAGCATTTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGC

    400     .    :    .    :    .    :    .    :    .    :
    374 AATGCTGGAATGCCAACAATTTTTG         GTCATAGAAGAGAACA
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 185578 AATGCTGGAATGCCAACAATTTTTGGTG...TAGGTCATAGAAGAGAACA

    450     .    :    .    :    .    :    .    :    .    :
    415 AAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 186962 AAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTC

    500     .    :    .    :    .    :    .    :    .    :
    465 TTCCGGCAAGCCATCAACCCCTCCGACAGGGTGAAGCTCTTTCCCCACCG
        |||||||||||||||| |||||||||||||||||||||||||||||||||
 187012 TTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCG

    550     .    :    .    :    .    :    .    :    .    :
    515 GAACTCAAGCAAGTGCAAGTCTAAGCCCCAAATTGCTGCTCTGAAAGAGG
        |||||||||||||||||||||||||||||| |||||||||||||||||||
 187062 GAACTCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGG

    600     .    :    .    :    .    :    .    :    .
    565 AGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCAT
        |||||||||||||||||||||||||||||||||||||||||||||
 187112 AGACAGAAGAAGAGGTGCAAGATACAAGGCTTTAGAGAGCAGCAT

END