Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX506811.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX506811.1, 752 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|32047420|gb|BX506811.1|BX506811 DKFZp779M191_r1 779 (synonym: hncc1) Homo sapiens cDNA clone DKFZp779M191 5', mRNA sequence
>ENSG00000001626

1-99  (62048-62146)   97% ->
100-282  (68679-68861)   100% ->
283-474  (79502-79693)   100% ->
475-569  (107777-107871)   100% ->
570-656  (110391-110477)   100% ->
657-752  (111972-112069)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 ATACAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTT
        | | ||||||||||||||||||||||||||||||||||||||||||||||
  62048 AAATAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTT

     50     .    :    .    :    .    :    .    :    .    :
     51 AACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
  62098 AACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGG

    100     .    :    .    :    .    :    .    :    .    :
    100         GGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
  62148 TC...CAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC

    150     .    :    .    :    .    :    .    :    .    :
    142 AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68721 AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTC

    200     .    :    .    :    .    :    .    :    .    :
    192 ACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68771 ACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAG

    250     .    :    .    :    .    :    .    :    .    :
    242 GACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAG         
        |||||||||||||||||||||||||||||||||||||||||>>>...>>>
  68821 GACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGGTA...CAG

    300     .    :    .    :    .    :    .    :    .    :
    283 ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79502 ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAA

    350     .    :    .    :    .    :    .    :    .    :
    333 AATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79552 AATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTA

    400     .    :    .    :    .    :    .    :    .    :
    383 TGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79602 TGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAA

    450     .    :    .    :    .    :    .    :    .    :
    433 TATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  79652 TATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGTA...TA

    500     .    :    .    :    .    :    .    :    .    :
    475  GACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 107776 GGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTG

    550     .    :    .    :    .    :    .    :    .    :
    524 GAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAG    
        ||||||||||||||||||||||||||||||||||||||||||||||>>>.
 107826 GAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGGTG.

    600     .    :    .    :    .    :    .    :    .    :
    570      AGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTT
        ..>>>|||||||||||||||||||||||||||||||||||||||||||||
 107876 ..TAGAGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTT

    650     .    :    .    :    .    :    .    :    .    :
    615 TGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 110436 TGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAGGTA...AA

    700     .    :    .    :    .    :    .    :    .    :
    657  CTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCT
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 111971 GCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCT

    750     .    :    .    :    .    :    .    :    .
    706 AAA TGGAACATTTAAAGAAAGCTGACAAA TATTAATTTTGCATGAAG
        |||-||||||||||||||||||||||||||-||||||||||||||||||
 112021 AAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAG

END