Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: BX641801.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/BX641801.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|34476120|gb|BX641801.1|BX641801 DKFZp686H17139_r1 686 (synonym: hlcc3) Homo sapiens cDNA clone DKFZp686H17139 5', mRNA sequence
>ENSG00000101017

5-132  (1-128)   99% ->
133-211  (3554-3632)   100% ->
212-337  (3967-4092)   100% ->
338-484  (4344-4490)   100% ->
485-589  (4860-4962)   95%

      0     .    :    .    :    .    :    .    :    .    :
      5 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT

     50     .    :    .    :    .    :    .    :    .    :
     55 GGTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGCCTCTGCAGTG
        |||||||||||||||||||||||||| |||||||||||||||||||||||
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG

    100     .    :    .    :    .    :    .    :    .    :
    105 CGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAAC

    150     .    :    .    :    .    :    .    :    .    :
    146 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3567 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT

    200     .    :    .    :    .    :    .    :    .    :
    196 TCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCAC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
   3617 TCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCAC

    250     .    :    .    :    .    :    .    :    .    :
    237 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3992 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG

    300     .    :    .    :    .    :    .    :    .    :
    287 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4042 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC

    350     .    :    .    :    .    :    .    :    .    :
    337 A         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   4092 AGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC

    400     .    :    .    :    .    :    .    :    .    :
    378 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4384 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT

    450     .    :    .    :    .    :    .    :    .    :
    428 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4434 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG

    500     .    :    .    :    .    :    .    :    .    :
    478 CAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4484 CAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTG

    550     .    :    .    :    .    :    .    :    .    :
    519 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4894 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC

    600     .    :    .    :
    569 CTTGGACAAGCTGTGAGANCA
        |||||||||| | | ||--||
   4944 CTTGGACAAGGTATAAG  CA

END