Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB141880.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB141880.1, 540 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|28117432|gb|CB141880.1|CB141880 K-EST0195548 L11SNU354s1 Homo sapiens cDNA clone L11SNU354s1-2-C04 5', mRNA sequence
>ENSG00000001626

25-540  (187651-188166)   99%

      0     .    :    .    :    .    :    .    :    .    :
     25 TACTGGTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAA
        || || ||||||||||||||||||||||||||||||||||||||||||||
 187651 TATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAAGCAAGTATTAGAA

     50     .    :    .    :    .    :    .    :    .    :
     75 TACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187701 TACCACAGGAACCACAAGACTGCACATCAAAATATGCCCCATTCAACATC

    100     .    :    .    :    .    :    .    :    .    :
    125 TAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187751 TAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGGAAATCAGGGTTAG

    150     .    :    .    :    .    :    .    :    .    :
    175 TATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187801 TATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACAATACA

    200     .    :    .    :    .    :    .    :    .    :
    225 TCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187851 TCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGATGG

    250     .    :    .    :    .    :    .    :    .    :
    275 TTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187901 TTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGAC

    300     .    :    .    :    .    :    .    :    .    :
    325 AAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187951 AAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGC

    350     .    :    .    :    .    :    .    :    .    :
    375 AAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188001 AAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGT

    400     .    :    .    :    .    :    .    :    .    :
    425 GTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188051 GTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCA

    450     .    :    .    :    .    :    .    :    .    :
    475 AGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188101 AGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTAT

    500     .    :    .
    525 GTACTTCATGCTGTCT
        ||||||||||||||||
 188151 GTACTTCATGCTGTCT

END