Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB150491.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB150491.1, 478 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|28133928|gb|CB150491.1|CB150491 K-EST0207285 C1SNU17 Homo sapiens cDNA clone C1SNU17-30-H04 5', mRNA sequence
>ENSG00000012048

(complement)

1-478  (79711-80191)   97%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTGACTGCAGCCAACCACACGTACAGAGCC CAGGACCCCA G ATGAGC
        ||||||||||||| ||||| ||||||||||-||||||||||-|-||||||
  79711 CTGACTGCAGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGC

     50     .    :    .    :    .    :    .    :    .    :
     48 TTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79761 TTACAAAGTGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCC

    100     .    :    .    :    .    :    .    :    .    :
     98 TTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGTTTATGA
        |||||||||||||||||||||||||||||||||||||||||||   | ||
  79811 TTCTACTGTCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGA

    150     .    :    .    :    .    :    .    :    .    :
    148 CTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79861 CTTCTGGCTATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCT

    200     .    :    .    :    .    :    .    :    .    :
    198 TGGAAATCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79911 TGGAAATCTGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGA

    250     .    :    .    :    .    :    .    :    .    :
    248 TTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79961 TTTTAAAACCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTAT

    300     .    :    .    :    .    :    .    :    .    :
    298 TTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAAGGCTGGGA
        ||||||||||||||||||||||||||||||||||||||||| |||||| |
  80011 TTATCAGCCCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAA

    350     .    :    .    :    .    :    .    :    .    :
    348 GCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80061 GCACAGAGTGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACT

    400     .    :    .    :    .    :    .    :    .    :
    398 TCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80111 TCTCTAAAACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGA

    450     .    :    .    :    .    :
    448 AGGAGAGTGCTTGGGATCGATTATGTGACTT
        |||||||||||||||||||||||||||||||
  80161 AGGAGAGTGCTTGGGATCGATTATGTGACTT

END