Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB158836.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB158836.1, 516 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|28144962|gb|CB158836.1|CB158836 K-EST0218255 L18POOL1n1 Homo sapiens cDNA clone L18POOL1n1-27-B07 5', mRNA sequence
>ENSG00000001626

1-516  (187903-188418)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187903 CCCTTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAA

     50     .    :    .    :    .    :    .    :    .    :
     51 GCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187953 GCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAA

    100     .    :    .    :    .    :    .    :    .    :
    101 ATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188003 ATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGT

    150     .    :    .    :    .    :    .    :    .    :
    151 GTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188053 GTAAGTAGATAGGCCATGGGCACTGTGGGTAGACACACATGAAGTCCAAG

    200     .    :    .    :    .    :    .    :    .    :
    201 CATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188103 CATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGATGTATGT

    250     .    :    .    :    .    :    .    :    .    :
    251 ACTTCATGCTGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188153 ACTTCATGCTGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCA

    300     .    :    .    :    .    :    .    :    .    :
    301 CCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188203 CCAATCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCA

    350     .    :    .    :    .    :    .    :    .    :
    351 AAATTTTTTCTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188253 AAATTTTTTCTCTAGGAAATATTTATTTTAATAATGTTTCAAACATATAT

    400     .    :    .    :    .    :    .    :    .    :
    401 AACAATGCTGTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188303 AACAATGCTGTATTTTAAAAGAATGATTATGAATTACATTTGTATAAAAT

    450     .    :    .    :    .    :    .    :    .    :
    451 AATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTATTTCTATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188353 AATTTTTATATTTGAAATATTGACTTTTTATGGCACTAGTATTTCTATGA

    500     .    :    .
    501 AATATTATGTTAAAAC
        ||||||||||||||||
 188403 AATATTATGTTAAAAC

END