Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB161052.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB161052.1, 525 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|28147178|gb|CB161052.1|CB161052 K-EST0220834 L18POOL1n1 Homo sapiens cDNA clone L18POOL1n1-28-A06 5', mRNA sequence
>ENSG00000140443

(complement)

1-95  (36041-36135)   100% <-
96-300  (41407-41611)   100% <-
301-418  (42152-42269)   100% <-
419-525  (45001-45107)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGATGTTGTAGGTGTCTGCGGCCGTGGTGTTCCTGCTTCGGCTGGACATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  36041 TGATGTTGTAGGTGTCTGCGGCCGTGGTGTTCCTGCTTCGGCTGGACATG

     50     .    :    .    :    .    :    .    :    .    :
     51 GTGGTGTTGGCCACTTGCATGACATCTCTCCGCTTCCTTTCAGGT     
        |||||||||||||||||||||||||||||||||||||||||||||<<<..
  36091 GTGGTGTTGGCCACTTGCATGACATCTCTCCGCTTCCTTTCAGGTCTG..

    100     .    :    .    :    .    :    .    :    .    :
     96     CTGGGCACGAAGATGGAGTTGTGCAGGAAATTCTCAAAGACTTTGC
        .<<<||||||||||||||||||||||||||||||||||||||||||||||
  36141 .TACCTGGGCACGAAGATGGAGTTGTGCAGGAAATTCTCAAAGACTTTGC

    150     .    :    .    :    .    :    .    :    .    :
    142 GGTATTCAGCCTCCTCCTTCTCGGCCTGCTTCTCGGCTTCAGTTTTGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41453 GGTATTCAGCCTCCTCCTTCTCGGCCTGCTTCTCGGCTTCAGTTTTGGGG

    200     .    :    .    :    .    :    .    :    .    :
    192 CAGGCGCAGCAAGGCCCTTTCTCCCCACCACACACCTCAGTCTTGGGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41503 CAGGCGCAGCAAGGCCCTTTCTCCCCACCACACACCTCAGTCTTGGGGTT

    250     .    :    .    :    .    :    .    :    .    :
    242 CTCTGTGACCTCCTCAATGTCGATGGTGCCGTCGGCATACTTCCTGATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  41553 CTCTGTGACCTCCTCAATGTCGATGGTGCCGTCGGCATACTTCCTGATGG

    300     .    :    .    :    .    :    .    :    .    :
    292 GGATTTTGT         CTTTGGAGCAGTAATTGTGCCGGTAAAGGTAG
        |||||||||<<<...<<<||||||||||||||||||||||||||||||||
  41603 GGATTTTGTCTT...TACCTTTGGAGCAGTAATTGTGCCGGTAAAGGTAG

    350     .    :    .    :    .    :    .    :    .    :
    333 CCGTCCTGAGGCTGCCGCTGCCAGCGCACAATGTAGTAACTCAGGTTGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42184 CCGTCCTGAGGCTGCCGCTGCCAGCGCACAATGTAGTAACTCAGGTTGCC

    400     .    :    .    :    .    :    .    :    .    :
    383 GTTGGGCAGAGAGGGAGGGTTCCACTTCACGATTAA         CTGAA
        ||||||||||||||||||||||||||||||||||||<<<...<<<|||||
  42234 GTTGGGCAGAGAGGGAGGGTTCCACTTCACGATTAACTG...TACCTGAA

    450     .    :    .    :    .    :    .    :    .    :
    424 GCATTGGTGCGAATGTACAAGATCTCACTCTTGGCCCCACGGATATGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45006 GCATTGGTGCGAATGTACAAGATCTCACTCTTGGCCCCACGGATATGGTC

    500     .    :    .    :    .    :    .    :    .    :
    474 GTTCTCCACCATGGTGAGGGTCACAGCCTTGACGTAAACGGCGTACTGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  45056 GTTCTCCACCATGGTGAGGGTCACAGCCTTGACGTAAACGGCGTACTGAG

    550 
    524 TC
        ||
  45106 TC

END