Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB854593.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB854593.1, 627 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|30044970|gb|CB854593.1|CB854593 UI-CF-DU1-aay-b-02-0-UI.s1 UI-CF-DU1 Homo sapiens cDNA clone UI-CF-DU1-aay-b-02-0-UI 3', mRNA sequence
>ENSG00000001626

(complement)

20-627  (1-608)   98%

      0     .    :    .    :    .    :    .    :    .    :
     20 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACACAAATGTATGGATTTTATTGACAAGTGATATTTTCTTACAGTAATAA

     50     .    :    .    :    .    :    .    :    .    :
     70 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 ATATAATGCAGTCTTCTTAAGAGTCAGTTTGGAGTTGAGAAGGCAGTGTA

    100     .    :    .    :    .    :    .    :    .    :
    120 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 CCCTTGATGGAAACAGTCAGACTGGTGGTACCATCTTCTTCAGAACTGCA

    150     .    :    .    :    .    :    .    :    .    :
    170 TCTAAAAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAAGTGC
        ||||| |||||||||||||||||||||||||||||||||||||||| |||
    151 TCTAAGAGGCTGTGCTGGCTGGGAATCATACAGCTGTGGGCAACAACTGC

    200     .    :    .    :    .    :    .    :    .    :
    220 ATCAGCCCCAGGGGTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG
        |||||||||| || ||||||||||||||||||||||||||||||||||||
    201 ATCAGCCCCAAGGCTTCCCTCCAGACCAAAAGGTGATTCATGGCCCCTGG

    250     .    :    .    :    .    :    .    :    .    :
    270 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    251 TTAATATCACCCTAGGTTCTCCCCTGTCCCAGTTTTAACATAATATTTCA

    300     .    :    .    :    .    :    .    :    .    :
    320 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    301 TAGAAATACTAGTGCCATAAAAAGTCAATATTTCAAATATAAAAATTATT

    350     .    :    .    :    .    :    .    :    .    :
    370 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    351 TTATACAAATGTAATTCATAATCATTCTTTTAAAATACAGCATTGTTATA

    400     .    :    .    :    .    :    .    :    .    :
    420 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAA TTTTGC
        |||||||||||||||||||||||||||||||||||||||||||-||||||
    401 TATGTTTGAAACATTATTAAAATAAATATTTCCTAGAGAAAAAATTTTGC

    450     .    :    .    :    .    :    .    :    .    :
    469 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||| 
    451 TTCACAAAATTATAAAACAGAAGCATATAAAACTAATTCATGATTGGTGC

    500     .    :    .    :    .    :    .    :    .    :
    519 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGGGTAGACAGCATGAAGTACA
        |||||||||||||||||||||||||||||| |||||||||||||||||||
    501 TTCTTCAGTGTGTCTCTCATTCTCTCTTAGTGTAGACAGCATGAAGTACA

    550     .    :    .    :    .    :    .    :    .    :
    569 TACATCTAGCCTGGAAAACATACCACCATCAACCTATACATCTAAATGCT
        |||||||||||||-||||||||||||||||||||||||||||||||||||
    551 TACATCTAGCCTG AAAACATACCACCATCAACCTATACATCTAAATGCT

    600     .
    619 TGGACTTCA
        |||||||||
    600 TGGACTTCA

END