Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB959991.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB959991.1, 796 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|30216107|gb|CB959991.1|CB959991 AGENCOURT_13888044 NIH_MGC_147 Homo sapiens cDNA clone IMAGE:30341081 5', mRNA sequence
>ENSG00000017427

(complement)

27-98  (1994-2064)   94% ->
99-255  (4748-4904)   100% ->
256-437  (60857-61038)   100% ->
438-749  (77981-78292)   100%

      0     .    :    .    :    .    :    .    :    .    :
     27 GGACCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACA
        ||-|||||||||||||||||||||||||||||||||||||||||||||||
   1994 GG CCTCATAATACCCACCCTGACCTGCTGTAAAAGACCTGGAACAAACA

     50     .    :    .    :    .    :    .    :    .    :
     77 AAAATGATTACACCTACAG CAG         GTGAAGATGCACACCATG
        |||||||||||||||||||- |->>>...>>>||||||||||||||||||
   2043 AAAATGATTACACCTACAGTGA GTA...CAGGTGAAGATGCACACCATG

    100     .    :    .    :    .    :    .    :    .    :
    117 TCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTTCACCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4766 TCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTTCACCAG

    150     .    :    .    :    .    :    .    :    .    :
    167 CTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4816 CTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGATG

    200     .    :    .    :    .    :    .    :    .    :
    217 CTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCA         AC
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
   4866 CTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAGTA...CAGAC

    250     .    :    .    :    .    :    .    :    .    :
    258 AAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60859 AAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCAT

    300     .    :    .    :    .    :    .    :    .    :
    308 CGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60909 CGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGT

    350     .    :    .    :    .    :    .    :    .    :
    358 ATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60959 ATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGTGCCCAG

    400     .    :    .    :    .    :    .    :    .    :
    408 CGCCACACCGACATGCCCAAGACCCAGAAG         GAAGTACATTT
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  61009 CGCCACACCGACATGCCCAAGACCCAGAAGGTA...TAGGAAGTACATTT

    450     .    :    .    :    .    :    .    :    .    :
    449 GAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77992 GAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGATGTAGG

    500     .    :    .    :    .    :    .    :    .    :
    499 AAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78042 AAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATCCTTTGC

    550     .    :    .    :    .    :    .    :    .    :
    549 TCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78092 TCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAATAAGTT

    600     .    :    .    :    .    :    .    :    .    :
    599 TGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78142 TGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACAAGTAAA

    650     .    :    .    :    .    :    .    :    .    :
    649 CATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78192 CATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAATGGTCCT

    700     .    :    .    :    .    :    .    :    .    :
    699 GGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTATAGAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78242 GGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTATAGAAAA

    750 
    749 G
        |
  78292 G

END