Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CB988450.1
Subject Sequence ID: ENSG00000131828
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/CB988450.1, 768 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000131828 (ENSG00000131828), 15915 bp

>gi|30282970|gb|CB988450.1|CB988450 AGENCOURT_13903538 NIH_MGC_147 Homo sapiens cDNA clone IMAGE:30342303 5', mRNA sequence
>ENSG00000131828

21-154  (30-162)   97% ->
155-214  (5380-5439)   100% ->
215-388  (6005-6178)   100% ->
389-515  (7349-7475)   100% ->
516-768  (9150-9395)   96%

      0     .    :    .    :    .    :    .    :    .    :
     21 GAACCAGGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGT
        |||  ||-||||||||||||||||||||||||||||||||||||||||||
     30 GAAGGAG ACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGT

     50     .    :    .    :    .    :    .    :    .    :
     71 CGCCGCTGCCGCCACTGCCTGTGCTTCATGAGGAAGATGCTCGCCGCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     79 CGCCGCTGCCGCCACTGCCTGTGCTTCATGAGGAAGATGCTCGCCGCCGT

    100     .    :    .    :    .    :    .    :    .    :
    121 CTCCCGCGTGCTGTCTGGCGCTTCTCAGAAGCCG         GCAAGCA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
    129 CTCCCGCGTGCTGTCTGGCGCTTCTCAGAAGCCGGTG...AAGGCAAGCA

    150     .    :    .    :    .    :    .    :    .    :
    162 GAGTGCTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   5387 GAGTGCTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATT

    200     .    :    .    :    .    :    .    :    .    :
    212 AAG         AAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
   5437 AAGGTA...CAGAAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGT

    250     .    :    .    :    .    :    .    :    .    :
    253 CACAACAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6043 CACAACAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGC

    300     .    :    .    :    .    :    .    :    .    :
    303 AGACTGTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6093 AGACTGTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAA

    350     .    :    .    :    .    :    .    :    .    :
    353 ATTATTCGTGGTTTCTGTCACTTGTGTGATGGTCAG         GAAGC
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
   6143 ATTATTCGTGGTTTCTGTCACTTGTGTGATGGTCAGGTG...CAGGAAGC

    400     .    :    .    :    .    :    .    :    .    :
    394 TTGCTGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7354 TTGCTGTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCA

    450     .    :    .    :    .    :    .    :    .    :
    444 CAGCCTACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7404 CAGCCTACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGA

    500     .    :    .    :    .    :    .    :    .    :
    494 GAAATTCTCGCAGAGCTTACAG         GACGAAAAGGAGGTTGTGC
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
   7454 GAAATTCTCGCAGAGCTTACAGGTT...CAGGACGAAAAGGAGGTTGTGC

    550     .    :    .    :    .    :    .    :    .    :
    535 TAAAGGGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9169 TAAAGGGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGG

    600     .    :    .    :    .    :    .    :    .    :
    585 GCAATGGCATCGTGGGAGCGCAGGTAGTCAAGGACGAAGATTGTGTGCTG
        ||||||||||||||||||||||||||||||||||||| ||||||||||||
   9219 GCAATGGCATCGTGGGAGCGCAGGTAGTCAAGGACGAGGATTGTGTGCTG

    650     .    :    .    :    .    :    .    :    .    :
    635 CTTTAGATTTGGCCCTGGACTTTGTCTTCAAAAACTTTCACAGCCCCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9269 CTTTAGATTTGGCCCTGGACTTTGTCTTCAAAAACTTTCACAGCCCCAGA

    700     .    :    .    :    .    :    .    :    .    :
    685 CAACTTTTCCTGAAAGTAGTACAGCCATGGTGCTGCACAGTGGACGCTTT
        ||||||||||||||-||||||||||||||-||||||||||||-|||||||
   9319 CAACTTTTCCTGAA GTAGTACAGCCATG TGCTGCACAGTG ACGCTTT

    750     .    :    .    :    .    :
    735 TGGTCAATTGTCGCATATATTGATGTTGGAACCC
        -||||||-||||||||||||-|||||||||-|||
   9366  GGTCAA TGTCGCATATAT GATGTTGGA CCC

END