Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CD673051.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CD673051.1, 653 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|32174782|gb|CD673051.1|CD673051 fg19h05.y1 Human Iris cDNA (Normalized): fg Homo sapiens cDNA clone fg19h05 5', mRNA sequence
>ENSG00000101017

1-88  (41-128)   98% ->
89-167  (3554-3632)   100% ->
168-293  (3967-4092)   100% ->
294-440  (4344-4490)   100% ->
441-534  (4860-4953)   100% ->
535-596  (8374-8435)   100% ->
597-653  (9872-9928)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCCATGGTTCGTCTGC
        |||||||||||||||||||||||||||||||||||| |||||||||||||
     41 GGCGCCCAGTGGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGC

     50     .    :    .    :    .    :    .    :    .    :
     51 CTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCT         GTC
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
     91 CTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTC

    100     .    :    .    :    .    :    .    :    .    :
     92 CATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3557 CATCCAGAACCACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAG

    150     .    :    .    :    .    :    .    :    .    :
    142 TCAGTGCTGTTCTTTGTGCCAGCCAG         GACAGAAACTGGTGA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
   3607 TCAGTGCTGTTCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGA

    200     .    :    .    :    .    :    .    :    .    :
    183 GTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3982 GTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGC

    250     .    :    .    :    .    :    .    :    .    :
    233 GAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4032 GAATTCCTAGACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATA

    300     .    :    .    :    .    :    .    :    .    :
    283 CTGCGACCCCA         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
   4082 CTGCGACCCCAGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCA

    350     .    :    .    :    .    :    .    :    .    :
    324 CCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4374 CCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACG

    400     .    :    .    :    .    :    .    :    .    :
    374 AGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4424 AGTGAGGCCTGTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTT

    450     .    :    .    :    .    :    .    :    .    :
    424 TGGGGTCAAGCAGATTG         CTACAGGGGTTTCTGATACCATCT
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
   4474 TGGGGTCAAGCAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCT

    500     .    :    .    :    .    :    .    :    .    :
    465 GCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4884 GCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAA

    550     .    :    .    :    .    :    .    :    .    :
    515 AAATGTCACCCTTGGACAAG         CTGTGAGACCAAAGACCTGGT
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
   4934 AAATGTCACCCTTGGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGT

    600     .    :    .    :    .    :    .    :    .    :
    556 TGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTG         
        |||||||||||||||||||||||||||||||||||||||||>>>...>>>
   8395 TGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTGGTG...CAG

    650     .    :    .    :    .    :    .    :    .    :
    597 GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9872 GTCCCCAGGATCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGG

    700     .
    647 ATCCTGT
        |||||||
   9922 ATCCTGT

END