Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CD676398.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CD676398.1, 508 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|32178129|gb|CD676398.1|CD676398 fs35h09.y1 Human Lens cDNA (Normalized): fs Homo sapiens cDNA clone fs35h09 5', mRNA sequence
>ENSG00000140443

1-138  (251077-251214)   100% ->
139-353  (259136-259350)   100% ->
354-480  (261766-261892)   99% ->
481-508  (263495-263522)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCACAGTGTCCTCCCCACTGGGGAACACCAATCCTTAAAAAACTTCTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251077 GCACAGTGTCCTCCCCACTGGGGAACACCAATCCTTAAAAAACTTCTTTC

     50     .    :    .    :    .    :    .    :    .    :
     51 TCATTGCAAATCGAAGGAGGCTGCCGCTGCACCCAGCCCCAGACTCCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 251127 TCATTGCAAATCGAAGGAGGCTGCCGCTGCACCCAGCCCCAGACTCCTCA

    100     .    :    .    :    .    :    .    :    .    :
    101 GTCACTTACCTGGCAAGCTGAGGCCCTACCAGTTTAAG         GAA
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 251177 GTCACTTACCTGGCAAGCTGAGGCCCTACCAGTTTAAGGTG...TAGGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 TTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259139 TTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACT

    200     .    :    .    :    .    :    .    :    .    :
    192 GGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259189 GGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTC

    250     .    :    .    :    .    :    .    :    .    :
    242 AATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259239 AATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGG

    300     .    :    .    :    .    :    .    :    .    :
    292 GACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259289 GACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGG

    350     .    :    .    :    .    :    .    :    .    :
    342 AGAGAGCCTCCT         GTGAAAGTGACGTCCTGCATTTCACCTCC
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
 259339 AGAGAGCCTCCTGTG...CAGGTGAAAGTGACGTCCTGCATTTCACCTCC

    400     .    :    .    :    .    :    .    :    .    :
    383 ACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCAGTACCGGCC
        |||||||||||||||||||||||||||||||||||||||| |||||||||
 261795 ACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTACCGGCC

    450     .    :    .    :    .    :    .    :    .    :
    433 CCCTGACTACAGGGATCTCATCAGCTTCACCGTTTACTACAAGGAAGC  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
 261845 CCCTGACTACAGGGATCTCATCAGCTTCACCGTTTACTACAAGGAAGCGT

    500     .    :    .    :    .    :    .
    481        ACCCTTTAAGAATGTCACAGAGTATGAT
        >...>>>||||||||||||||||||||||||||||
 261895 G...CAGACCCTTTAAGAATGTCACAGAGTATGAT

END