Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CK822698.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CK822698.1, 548 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|44839623|gb|CK822698.1|CK822698 ig96a07.x5 HR85 islet Homo sapiens cDNA clone IMAGE:5611285 3', mRNA sequence
>ENSG00000012048

(complement)

1-548  (80036-80583)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGCCTCAAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80036 GGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGCCTCAAGAG

     50     .    :    .    :    .    :    .    :    .    :
     51 AATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGTTCACAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80086 AATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGTTCACAAAG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGATCGATTATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80136 GCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGATCGATTATG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTTGGAGTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80186 TGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTTGGAGTGGA

    200     .    :    .    :    .    :    .    :    .    :
    201 ACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAAGGAAACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80236 ACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAAGGAAACTT

    250     .    :    .    :    .    :    .    :    .    :
    251 GAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80286 GAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGGC

    300     .    :    .    :    .    :    .    :    .    :
    301 CAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGCCTGGCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80336 CAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGCCTGGCCAA

    350     .    :    .    :    .    :    .    :    .    :
    351 CATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCCGGTCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80386 CATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCCGGTCATGG

    400     .    :    .    :    .    :    .    :    .    :
    401 TGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCAGGAGAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80436 TGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCAGGAGAATC

    450     .    :    .    :    .    :    .    :    .    :
    451 ACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80486 ACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACGGC

    500     .    :    .    :    .    :    .    :    .
    501 ACTCCAACCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAA
        |||||| |||||||||||||||||||||||||||||||||||||||||
  80536 ACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAA

END