Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CK902357.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CK902357.1, 360 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|45363888|gb|CK902357.1|CK902357 il52c06.y5 HR85 islet Homo sapiens cDNA clone IMAGE:6033419 5' similar to SW:IGF1_CAVPO P17647 INSULIN-LIKE GROWTH FACTOR I PRECURSOR ;, mRNA sequence
>ENSG00000017427

1-245  (68-312)   99% <-
246-360  (17255-17369)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTATTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     68 GGTGCAAATCACTCCTAAAGACAATGTTGGAATGTTTACTTGTGTATTTC

     50     .    :    .    :    .    :    .    :    .    :
     51 ATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTTGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    118 ATTGGGGGAAACGCCCATCTTTTAAATGTTATCAAACTTATTTTTTGGTA

    100     .    :    .    :    .    :    .    :    .    :
    101 GGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCTGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    168 GGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAGCAAAGGATCCTGCGG

    150     .    :    .    :    .    :    .    :    .    :
    151 TGGCATGTCTCTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGTAGTT
        ||||||||| ||||||||||||||||||||||||||||||||||||||||
    218 TGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTCCTACATCCTGTAGTT

    200     .    :    .    :    .    :    .    :    .    :
    201 CTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTC     
        |||||||||||||||||||||||||||||||||||||||||||||<<<..
    268 CTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCAAATGTACTTCCTA..

    250     .    :    .    :    .    :    .    :    .    :
    246     CTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGCACGGACAGAG
        .<<<||||||||||||||||||||||||||||||||||||||||||||||
    318 .TACCTTCTGGGTCTTGGGCATGTCGGTGTGGCGCTGGGCACGGACAGAG

    300     .    :    .    :    .    :    .    :    .    :
    292 CGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCTCCAGCCTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  17301 CGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAATACATCTCCAGCCTCCT

    350     .    :    .
    342 TAGATCACAGCTCCGGAAG
        |||||||||||||||||||
  17351 TAGATCACAGCTCCGGAAG

END