Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN407392.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN407392.1, 252 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|47398691|gb|CN407392.1|CN407392 17000600170932 GRN_PRENEU Homo sapiens cDNA 5', mRNA sequence
>ENSG00000012048

(complement)

1-252  (80217-80468)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATT
         |||||||||||||||||||||||||||||||||||||||||||||||||
  80217 TCTCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATT

     50     .    :    .    :    .    :    .    :    .    :
     51 AGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80267 AGAAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAA

    100     .    :    .    :    .    :    .    :    .    :
    101 TCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80317 TCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGT

    150     .    :    .    :    .    :    .    :    .    :
    151 TCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80367 TCGAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATAC

    200     .    :    .    :    .    :    .    :    .    :
    201 AGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80417 AGAAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGG

    250 
    251 TG
        ||
  80467 TG

END