Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414632.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414632.1, 652 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402226|gb|CN414632.1|CN414632 17000532545482 GRN_ES Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-205  (263528-263733)   99% ->
206-373  (266415-266582)   100% ->
374-578  (267123-267327)   100% ->
579-652  (272599-272672)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGATGCCTGCGGCTCCA CAGCTGGAACATGGTGGACGTGGACCTCCCGC
        |||||||||||||||||-||||||||||||||||||||||||||||||||
 263528 GGATGCCTGCGGCTCCAACAGCTGGAACATGGTGGACGTGGACCTCCCGC

     50     .    :    .    :    .    :    .    :    .    :
     50 CCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTGAAGCCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263578 CCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTGAAGCCCTGG

    100     .    :    .    :    .    :    .    :    .    :
    100 ACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCATGGTGGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263628 ACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCATGGTGGAGAA

    150     .    :    .    :    .    :    .    :    .    :
    150 CGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGCACCAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263678 CGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTCGCACCAATG

    200     .    :    .    :    .    :    .    :    .    :
    200 CTTCAG         TTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCG
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
 263728 CTTCAGGTA...CAGTTCCTTCCATTCCCTTGGACGTTCTTTCAGCATCG

    250     .    :    .    :    .    :    .    :    .    :
    241 AACTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266450 AACTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAA

    300     .    :    .    :    .    :    .    :    .    :
    291 CGGCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266500 CGGCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACG

    350     .    :    .    :    .    :    .    :    .    :
    341 GCTACCTTTACCGGCACAATTACTGCTCCAAAG         ACAAAATC
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 266550 GCTACCTTTACCGGCACAATTACTGCTCCAAAGGTA...AAGACAAAATC

    400     .    :    .    :    .    :    .    :    .    :
    382 CCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267131 CCCATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGA

    450     .    :    .    :    .    :    .    :    .    :
    432 GAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267181 GAACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCT

    500     .    :    .    :    .    :    .    :    .    :
    482 GCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267231 GCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATAC

    550     .    :    .    :    .    :    .    :    .    :
    532 CGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
 267281 CGCAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAGGTA

    600     .    :    .    :    .    :    .    :    .    :
    579       ACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
 267331 ...CAGACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCA

    650     .    :    .    :    .    :
    623 CCATGTCCAGCCGAAGCAGGAACACCACGG
        ||||||||||||||||||||||||||||||
 272643 CCATGTCCAGCCGAAGCAGGAACACCACGG

END