Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414634.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414634.1, 757 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402228|gb|CN414634.1|CN414634 17000531844645 GRN_ES Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-100  (241988-242088)   97% ->
101-249  (247208-247356)   100% ->
250-394  (249928-250072)   100% ->
395-609  (259136-259350)   100% ->
610-736  (261766-261892)   100% ->
737-757  (263495-263515)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCCT AGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGACGG
          |||-||||||||||||||||||||||||||||||||||||||||||||
 241988 ATCCTCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGACGG

     50     .    :    .    :    .    :    .    :    .    :
     50 CGAGTGCATGCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 242038 CGAGTGCATGCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGA

    100     .    :    .    :    .    :    .    :    .    :
    100 G         CATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
 242088 GGTC...CAGCATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTC

    150     .    :    .    :    .    :    .    :    .    :
    141 TGTGAGGAAGAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247248 TGTGAGGAAGAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCTCA

    200     .    :    .    :    .    :    .    :    .    :
    191 GATGCTCCAAGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247298 GATGCTCCAAGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCC

    250     .    :    .    :    .    :    .    :    .    :
    241 GACGGGGGA         ATAACATTGCTTCAGAGCTGGAGAACTTCATG
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
 247348 GACGGGGGAGTA...TAGATAACATTGCTTCAGAGCTGGAGAACTTCATG

    300     .    :    .    :    .    :    .    :    .    :
    282 GGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249960 GGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGC

    350     .    :    .    :    .    :    .    :    .    :
    332 CTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250010 CTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGG

    400     .    :    .    :    .    :    .    :    .    :
    382 AGCAGCTAGAAGG         GAATTACTCCTTCTACGTCCTCGACAAC
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
 250060 AGCAGCTAGAAGGGTA...TAGGAATTACTCCTTCTACGTCCTCGACAAC

    450     .    :    .    :    .    :    .    :    .    :
    423 CAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259164 CAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAA

    500     .    :    .    :    .    :    .    :    .    :
    473 AGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259214 AGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAA

    550     .    :    .    :    .    :    .    :    .    :
    523 TTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259264 TTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGG

    600     .    :    .    :    .    :    .    :    .    :
    573 GACATAAACACCAGGAACAACGGGGAGAGAGCCTCCT         GTGA
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
 259314 GACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTG...CAGGTGA

    650     .    :    .    :    .    :    .    :    .    :
    614 AAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261770 AAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCA

    700     .    :    .    :    .    :    .    :    .    :
    664 TCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCTCATCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261820 TCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCTCATCAGC

    750     .    :    .    :    .    :    .    :    .    :
    714 TTCACCGTTTACTACAAGGAAGC         ACCCTTTAAGAATGTCAC
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 261870 TTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTTAAGAATGTCAC

    800 
    755 AGA
        |||
 263513 AGA

END