Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414640.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414640.1, 469 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402234|gb|CN414640.1|CN414640 17000600003159 GRN_PRENEU Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-131  (266452-266582)   100% ->
132-336  (267123-267327)   100% ->
337-469  (272599-272731)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266452 CTCCTCTTCTCAGTTAATCGTGAAGTGGAACCCTCCCTCTCTGCCCAACG

     50     .    :    .    :    .    :    .    :    .    :
     51 GCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266502 GCAACCTGAGTTACTACATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGC

    100     .    :    .    :    .    :    .    :    .    :
    101 TACCTTTACCGGCACAATTACTGCTCCAAAG         ACAAAATCCC
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 266552 TACCTTTACCGGCACAATTACTGCTCCAAAGGTA...AAGACAAAATCCC

    150     .    :    .    :    .    :    .    :    .    :
    142 CATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267133 CATCAGGAAGTATGCCGACGGCACCATCGACATTGAGGAGGTCACAGAGA

    200     .    :    .    :    .    :    .    :    .    :
    192 ACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267183 ACCCCAAGACTGAGGTGTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGC

    250     .    :    .    :    .    :    .    :    .    :
    242 CCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267233 CCCAAAACTGAAGCCGAGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCG

    300     .    :    .    :    .    :    .    :    .    :
    292 CAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
 267283 CAAAGTCTTTGAGAATTTCCTGCACAACTCCATCTTCGTGCCCAGGTA..

    350     .    :    .    :    .    :    .    :    .    :
    337     ACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
 267333 .CAGACCTGAAAGGAAGCGGAGAGATGTCATGCAAGTGGCCAACACCACC

    400     .    :    .    :    .    :    .    :    .    :
    383 ATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272645 ATGTCCAGCCGAAGCAGGAACACCACGGCCGCAGACACCTACAACATCAC

    450     .    :    .    :    .    :    .
    433 CGACCCGGAAGAGCTGGAGACAGAGTACCCTTTCTTT
        |||||||||||||||||||||||||||||||||||||
 272695 CGACCCGGAAGAGCTGGAGACAGAGTACCCTTTCTTT

END