Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414643.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414643.1, 368 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402237|gb|CN414643.1|CN414643 17000424045312 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-153  (266430-266582)   99% ->
154-358  (267123-267327)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGG
         |||||||||||||||||||||||||||||||||||||||||||||||||
 266430 TGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGG

     50     .    :    .    :    .    :    .    :    .    :
     51 AACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266480 AACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACTGCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266530 GCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACTGCTCCA

    150     .    :    .    :    .    :    .    :    .    :
    151 AAG         ACAAAATCCCCATCAGGAAGTATGCCGACGGCACCATC
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 266580 AAGGTA...AAGACAAAATCCCCATCAGGAAGTATGCCGACGGCACCATC

    200     .    :    .    :    .    :    .    :    .    :
    192 GACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267161 GACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGA

    250     .    :    .    :    .    :    .    :    .    :
    242 GAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267211 GAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCG

    300     .    :    .    :    .    :    .    :    .    :
    292 AGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267261 AGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAAC

    350     .    :    .
    342 TCCATCTTCGTGCCCAG
        |||||||||||||||||
 267311 TCCATCTTCGTGCCCAG

END