Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414645.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414645.1, 589 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402239|gb|CN414645.1|CN414645 17000531496134 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-16  (247341-247356)   100% ->
17-160  (249928-250072)   99% ->
161-375  (259136-259350)   100% ->
376-502  (261766-261892)   100% ->
503-589  (263495-263581)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 AACATCCGACGGGGGA         ATA CATTGCTTCAGAGCTGGAGAA
        ||||||||||||||||>>>...>>>|||-|||||||||||||||||||||
 247341 AACATCCGACGGGGGAGTA...TAGATAACATTGCTTCAGAGCTGGAGAA

     50     .    :    .    :    .    :    .    :    .    :
     41 CTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249953 CTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATT

    100     .    :    .    :    .    :    .    :    .    :
     91 CTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250003 CTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTA

    150     .    :    .    :    .    :    .    :    .    :
    141 GGAGAGGAGCAGCTAGAAGG         GAATTACTCCTTCTACGTCCT
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 250053 GGAGAGGAGCAGCTAGAAGGGTA...TAGGAATTACTCCTTCTACGTCCT

    200     .    :    .    :    .    :    .    :    .    :
    182 CGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259157 CGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGA

    250     .    :    .    :    .    :    .    :    .    :
    232 CCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259207 CCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTT

    300     .    :    .    :    .    :    .    :    .    :
    282 TCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259257 TCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAG

    350     .    :    .    :    .    :    .    :    .    :
    332 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCT      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
 259307 CAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTG...

    400     .    :    .    :    .    :    .    :    .    :
    376    GTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAAT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
 261763 CAGGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAAT

    450     .    :    .    :    .    :    .    :    .    :
    423 CGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261813 CGCATCATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCT

    500     .    :    .    :    .    :    .    :    .    :
    473 CATCAGCTTCACCGTTTACTACAAGGAAGC         ACCCTTTAAGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 261863 CATCAGCTTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTTAAGA

    550     .    :    .    :    .    :    .    :    .    :
    514 ATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263506 ATGTCACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAAC

    600     .    :    .    :    .
    564 ATGGTGGACGTGGACCTCCCGCCCAA
        ||||||||||||||||||||||||||
 263556 ATGGTGGACGTGGACCTCCCGCCCAA

END