Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414646.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414646.1, 488 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402240|gb|CN414646.1|CN414646 17000531466780 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-154  (241053-241206)   100% ->
155-467  (241776-242088)   100% ->
468-488  (247208-247228)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CTCACCCTGAATTATTCTTGCGTAAGATCTAAGAACCCTCTCTTGGGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241053 CTCACCCTGAATTATTCTTGCGTAAGATCTAAGAACCCTCTCTTGGGGTC

     50     .    :    .    :    .    :    .    :    .    :
     51 TGGATCAGGACTCCTTTCCTGTAACACACCTATGTTCTTGGACTTAAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241103 TGGATCAGGACTCCTTTCCTGTAACACACCTATGTTCTTGGACTTAAGAA

    100     .    :    .    :    .    :    .    :    .    :
    101 TGACCCTCAGACATGGTGACTTCTTTGTCATCTAACAGCTTTGGCTTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241153 TGACCCTCAGACATGGTGACTTCTTTGTCATCTAACAGCTTTGGCTTATT

    150     .    :    .    :    .    :    .    :    .    :
    151 TGAG         TGTGCCCAAGCACGTGTGGGAAGCGGGCGTGCACCGA
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
 241203 TGAGGTA...CAGTGTGCCCAAGCACGTGTGGGAAGCGGGCGTGCACCGA

    200     .    :    .    :    .    :    .    :    .    :
    192 GAACAATGAGTGCTGCCACCCCGAGTGCCTGGGCAGCTGCAGCGCGCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241813 GAACAATGAGTGCTGCCACCCCGAGTGCCTGGGCAGCTGCAGCGCGCCTG

    250     .    :    .    :    .    :    .    :    .    :
    242 ACAACGACACGGCCTGTGTAGCTTGCCGCCACTACTACTATGCCGGTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241863 ACAACGACACGGCCTGTGTAGCTTGCCGCCACTACTACTATGCCGGTGTC

    300     .    :    .    :    .    :    .    :    .    :
    292 TGTGTGCCTGCCTGCCCGCCCAACACCTACAGGTTTGAGGGCTGGCGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241913 TGTGTGCCTGCCTGCCCGCCCAACACCTACAGGTTTGAGGGCTGGCGCTG

    350     .    :    .    :    .    :    .    :    .    :
    342 TGTGGACCGTGACTTCTGCGCCAACATCCTCAGCGCCGAGAGCAGCGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241963 TGTGGACCGTGACTTCTGCGCCAACATCCTCAGCGCCGAGAGCAGCGACT

    400     .    :    .    :    .    :    .    :    .    :
    392 CCGAGGGGTTTGTGATCCACGACGGCGAGTGCATGCAGGAGTGCCCCTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 242013 CCGAGGGGTTTGTGATCCACGACGGCGAGTGCATGCAGGAGTGCCCCTCG

    450     .    :    .    :    .    :    .    :    .    :
    442 GGCTTCATCCGCAACGGCAGCCAGAG         CATGTACTGCATCCC
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
 242063 GGCTTCATCCGCAACGGCAGCCAGAGGTC...CAGCATGTACTGCATCCC

    500     .
    483 TTGTGA
        ||||||
 247223 TTGTGA

END