Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414649.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414649.1, 670 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402243|gb|CN414649.1|CN414649 17000424187827 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

6-65  (266524-266582)   96% ->
66-270  (267123-267327)   99% ->
271-555  (272599-272882)   99% ->
556-670  (274327-274441)   100%

      0     .    :    .    :    .    :    .    :    .    :
      6 GCGTCCGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTAC
        |||-| ||||||||||||||||||||||||||||||||||||||||||||
 266524 GCG CTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTAC

     50     .    :    .    :    .    :    .    :    .    :
     56 TGCTCCAAAG         ACAAAATCCCCATCAGGAAGTATGCCGACGG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 266573 TGCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTATGCCGACGG

    100     .    :    .    :    .    :    .    :    .    :
     97 CACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267154 CACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTG

    150     .    :    .    :    .    :    .    :    .    :
    147 GTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267204 GTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAG

    200     .    :    .    :    .    :    .    :    .    :
    197 CAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267254 CAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCT

    250     .    :    .    :    .    :    .    :    .    :
    247 GCACAACTCTATCTTCGTGCCCAG         ACCTGAAAGGAAGCGGA
        ||||||||| ||||||||||||||>>>...>>>|||||||||||||||||
 267304 GCACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAGGAAGCGGA

    300     .    :    .    :    .    :    .    :    .    :
    288 GAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAAGGAA
        |||||||||||||||||||||||||||||||||||||||||||||-||||
 272616 GAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCA GGAA

    350     .    :    .    :    .    :    .    :    .    :
    338 CACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCTGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272665 CACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCTGGAGA

    400     .    :    .    :    .    :    .    :    .    :
    388 CAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272715 CAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTC

    450     .    :    .    :    .    :    .    :    .    :
    438 ATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272765 ATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTG

    500     .    :    .    :    .    :    .    :    .    :
    488 CAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272815 CAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTG

    550     .    :    .    :    .    :    .    :    .    :
    538 CAAGGACTATGCCCGCAG         AAGGAGCAGATGACATTCCTGGG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
 272865 CAAGGACTATGCCCGCAGGTA...CAGAAGGAGCAGATGACATTCCTGGG

    600     .    :    .    :    .    :    .    :    .    :
    579 CCAGTGACCTGGGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGTGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274350 CCAGTGACCTGGGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGTGGCC

    650     .    :    .    :    .    :    .    :
    629 GGAACCTGAGAATCCCAATGGATTGATTCTAATGTATGAAAT
        ||||||||||||||||||||||||||||||||||||||||||
 274400 GGAACCTGAGAATCCCAATGGATTGATTCTAATGTATGAAAT

END