Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414650.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414650.1, 657 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402244|gb|CN414650.1|CN414650 17000424708073 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-214  (240993-241206)   98% ->
215-527  (241776-242088)   100% ->
528-657  (247208-247337)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGGGAGTAGCCATTCTTCTGTTCCTTTACTTTTCTAATCAGCTTGCTTTC
          |||||||||||||||||||||||||||||| |||||||||||||||||
 240993 ATGGAGTAGCCATTCTTCTGTTCCTTTACTTTCCTAATCAGCTTGCTTTC

     50     .    :    .    :    .    :    .    :    .    :
     51 AGTTTACAGACTCACCCTGAATTATTCTTGCGTAAGATCTAAGAACCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241043 AGTTTACAGACTCACCCTGAATTATTCTTGCGTAAGATCTAAGAACCCTC

    100     .    :    .    :    .    :    .    :    .    :
    101 TCTTGGGGTCTGGATCAGGACTCCTTTCCTGTAACACACCTATGTTCTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241093 TCTTGGGGTCTGGATCAGGACTCCTTTCCTGTAACACACCTATGTTCTTG

    150     .    :    .    :    .    :    .    :    .    :
    151 GACTTAAGAATGACCCTCAGACATGGTGACTTCTTTGTCATCTAACAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241143 GACTTAAGAATGACCCTCAGACATGGTGACTTCTTTGTCATCTAACAGCT

    200     .    :    .    :    .    :    .    :    .    :
    201 TTGGCTTATTTGAG         TGTGCCCAAGCACGTGTGGGAAGCGGG
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 241193 TTGGCTTATTTGAGGTA...CAGTGTGCCCAAGCACGTGTGGGAAGCGGG

    250     .    :    .    :    .    :    .    :    .    :
    242 CGTGCACCGAGAACAATGAGTGCTGCCACCCCGAGTGCCTGGGCAGCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241803 CGTGCACCGAGAACAATGAGTGCTGCCACCCCGAGTGCCTGGGCAGCTGC

    300     .    :    .    :    .    :    .    :    .    :
    292 AGCGCGCCTGACAACGACACGGCCTGTGTAGCTTGCCGCCACTACTACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241853 AGCGCGCCTGACAACGACACGGCCTGTGTAGCTTGCCGCCACTACTACTA

    350     .    :    .    :    .    :    .    :    .    :
    342 TGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAACACCTACAGGTTTGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241903 TGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAACACCTACAGGTTTGAGG

    400     .    :    .    :    .    :    .    :    .    :
    392 GCTGGCGCTGTGTGGACCGTGACTTCTGCGCCAACATCCTCAGCGCCGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241953 GCTGGCGCTGTGTGGACCGTGACTTCTGCGCCAACATCCTCAGCGCCGAG

    450     .    :    .    :    .    :    .    :    .    :
    442 AGCAGCGACTCCGAGGGGTTTGTGATCCACGACGGCGAGTGCATGCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 242003 AGCAGCGACTCCGAGGGGTTTGTGATCCACGACGGCGAGTGCATGCAGGA

    500     .    :    .    :    .    :    .    :    .    :
    492 GTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGAG         CATGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
 242053 GTGCCCCTCGGGCTTCATCCGCAACGGCAGCCAGAGGTC...CAGCATGT

    550     .    :    .    :    .    :    .    :    .    :
    533 ACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTCTGTGAGGAAGAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247213 ACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGGTCTGTGAGGAAGAAAAG

    600     .    :    .    :    .    :    .    :    .    :
    583 AAAACAAAGACCATTGATTCTGTTACTTCTGCTCAGATGCTCCAAGGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247263 AAAACAAAGACCATTGATTCTGTTACTTCTGCTCAGATGCTCCAAGGATG

    650     .    :    .    :    .
    633 CACCATCTTCAAGGGCAATTTGCTC
        |||||||||||||||||||||||||
 247313 CACCATCTTCAAGGGCAATTTGCTC

END