Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414651.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414651.1, 276 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402245|gb|CN414651.1|CN414651 17000532178414 GRN_ES Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-215  (263519-263733)   100% ->
216-276  (266415-266474)   98%

      0     .    :    .    :    .    :    .    :    .    :
      1 TGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGTGGACGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263519 TGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGTGGACGTGG

     50     .    :    .    :    .    :    .    :    .    :
     51 ACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263569 ACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTACATGGGCTG

    100     .    :    .    :    .    :    .    :    .    :
    101 AAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263619 AAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACCCTCACCAT

    150     .    :    .    :    .    :    .    :    .    :
    151 GGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263669 GGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTTGTACATTC

    200     .    :    .    :    .    :    .    :    .    :
    201 GCACCAATGCTTCAG         TTCCTTCCATTCCCTTGAGACGTTCT
        |||||||||||||||>>>...>>>|||||||||||||||||-||||||||
 263719 GCACCAATGCTTCAGGTA...CAGTTCCTTCCATTCCCTTG GACGTTCT

    250     .    :    .    :    .    :    .
    242 TTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGA
        |||||||||||||||||||||||||||||||||||
 266440 TTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGA

END