Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414652.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414652.1, 601 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402246|gb|CN414652.1|CN414652 17000427622582 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

26-306  (58279-58558)   99% ->
307-601  (241776-242070)   100%

      0     .    :    .    :    .    :    .    :    .    :
     26 GAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58279 GAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTAC

     50     .    :    .    :    .    :    .    :    .    :
     76 TCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58329 TCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCCA

    100     .    :    .    :    .    :    .    :    .    :
    126 CTGTGGACTGGTCCCTGATCCTGGATGCGGGTGTCCAATAACTACATTGT
        ||||||||||||||||||||||||||||||-|||||||||||||||||||
  58379 CTGTGGACTGGTCCCTGATCCTGGATGCGG TGTCCAATAACTACATTGT

    150     .    :    .    :    .    :    .    :    .    :
    176 GGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58428 GGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGG

    200     .    :    .    :    .    :    .    :    .    :
    226 AGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58478 AGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTAC

    250     .    :    .    :    .    :    .    :    .    :
    276 CGCTGCTGGACCACAAACCGCTGCCAGAAAA         TGTGCCCAAG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  58528 CGCTGCTGGACCACAAACCGCTGCCAGAAAAGTA...CAGTGTGCCCAAG

    300     .    :    .    :    .    :    .    :    .    :
    317 CACGTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241786 CACGTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCG

    350     .    :    .    :    .    :    .    :    .    :
    367 AGTGCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241836 AGTGCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCT

    400     .    :    .    :    .    :    .    :    .    :
    417 TGCCGCCACTACTACTATGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241886 TGCCGCCACTACTACTATGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAA

    450     .    :    .    :    .    :    .    :    .    :
    467 CACCTACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACTTCTGCGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241936 CACCTACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACTTCTGCGCCA

    500     .    :    .    :    .    :    .    :    .    :
    517 ACATCCTCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241986 ACATCCTCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGAC

    550     .    :    .    :    .    :    .
    567 GGCGAGTGCATGCAGGAGTGCCCCTCGGGCTTCAT
        |||||||||||||||||||||||||||||||||||
 242036 GGCGAGTGCATGCAGGAGTGCCCCTCGGGCTTCAT

END