Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414653.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414653.1, 728 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402247|gb|CN414653.1|CN414653 17000424955918 GRN_EB Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-33  (263701-263733)   96% ->
34-201  (266415-266582)   100% ->
202-406  (267123-267327)   100% ->
407-690  (272599-272882)   99% ->
691-728  (274327-274364)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGGAGATCTTGTACATTCGCACCAATGCTTCAG         TTCCTTCC
        | |||||||||||||||||||||||||||||||>>>...>>>||||||||
 263701 GTGAGATCTTGTACATTCGCACCAATGCTTCAGGTA...CAGTTCCTTCC

     50     .    :    .    :    .    :    .    :    .    :
     42 ATTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266423 ATTCCCTTGGACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGT

    100     .    :    .    :    .    :    .    :    .    :
     92 GAAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266473 GAAGTGGAACCCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTG

    150     .    :    .    :    .    :    .    :    .    :
    142 TGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266523 TGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTAC

    200     .    :    .    :    .    :    .    :    .    :
    192 TGCTCCAAAG         ACAAAATCCCCATCAGGAAGTATGCCGACGG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 266573 TGCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTATGCCGACGG

    250     .    :    .    :    .    :    .    :    .    :
    233 CACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267154 CACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTG

    300     .    :    .    :    .    :    .    :    .    :
    283 GTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267204 GTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAG

    350     .    :    .    :    .    :    .    :    .    :
    333 CAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267254 CAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCT

    400     .    :    .    :    .    :    .    :    .    :
    383 GCACAACTCCATCTTCGTGCCCAG         ACCTGAAAGGAAGCGGA
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 267304 GCACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAGGAAGCGGA

    450     .    :    .    :    .    :    .    :    .    :
    424 GAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272616 GAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAAC

    500     .    :    .    :    .    :    .    :    .    :
    474 ACCACGGCCGCAGACACCTACAACATCACTGACCCGGAAGAGCTGGAGAC
        ||||||||||||||||||||||||||||| ||||||||||||||||||||
 272666 ACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCTGGAGAC

    550     .    :    .    :    .    :    .    :    .    :
    524 AGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272716 AGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTCA

    600     .    :    .    :    .    :    .    :    .    :
    574 TTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272766 TTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTGC

    650     .    :    .    :    .    :    .    :    .    :
    624 AACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272816 AACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGC

    700     .    :    .    :    .    :    .    :    .    :
    674 AAGGACTATGCCCGCAG         AAGGAGCAGATGACATTCCTGGGC
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
 272866 AAGGACTATGCCCGCAGGTA...CAGAAGGAGCAGATGACATTCCTGGGC

    750     .    :
    715 CAGTGACCTGGGAG
        ||||||||||||||
 274351 CAGTGACCTGGGAG

END