Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: CN414654.1
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/CN414654.1, 710 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|47402248|gb|CN414654.1|CN414654 17000600235310 GRN_PRENEU Homo sapiens cDNA 5', mRNA sequence
>ENSG00000140443

1-65  (266518-266582)   100% ->
66-270  (267123-267327)   100% ->
271-554  (272599-272882)   100% ->
555-691  (274327-274463)   100% ->
692-710  (274976-274994)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 CATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266518 CATTGTGCGCTGGCAGCGGCAGCCTCAGGACGGCTACCTTTACCGGCACA

     50     .    :    .    :    .    :    .    :    .    :
     51 ATTACTGCTCCAAAG         ACAAAATCCCCATCAGGAAGTATGCC
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 266568 ATTACTGCTCCAAAGGTA...AAGACAAAATCCCCATCAGGAAGTATGCC

    100     .    :    .    :    .    :    .    :    .    :
     92 GACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267149 GACGGCACCATCGACATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGT

    150     .    :    .    :    .    :    .    :    .    :
    142 GTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267199 GTGTGGTGGGGAGAAAGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCG

    200     .    :    .    :    .    :    .    :    .    :
    192 AGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267249 AGAAGCAGGCCGAGAAGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAAT

    250     .    :    .    :    .    :    .    :    .    :
    242 TTCCTGCACAACTCCATCTTCGTGCCCAG         ACCTGAAAGGAA
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
 267299 TTCCTGCACAACTCCATCTTCGTGCCCAGGTA...CAGACCTGAAAGGAA

    300     .    :    .    :    .    :    .    :    .    :
    283 GCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272611 GCGGAGAGATGTCATGCAAGTGGCCAACACCACCATGTCCAGCCGAAGCA

    350     .    :    .    :    .    :    .    :    .    :
    333 GGAACACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272661 GGAACACCACGGCCGCAGACACCTACAACATCACCGACCCGGAAGAGCTG

    400     .    :    .    :    .    :    .    :    .    :
    383 GAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272711 GAGACAGAGTACCCTTTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAAC

    450     .    :    .    :    .    :    .    :    .    :
    433 TGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272761 TGTCATTTCTAACCTTCGGCCTTTCACATTGTACCGCATCGATATCCACA

    500     .    :    .    :    .    :    .    :    .    :
    483 GCTGCAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272811 GCTGCAACCACGAGGCTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTC

    550     .    :    .    :    .    :    .    :    .    :
    533 TTTGCAAGGACTATGCCCGCAG         AAGGAGCAGATGACATTCC
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
 272861 TTTGCAAGGACTATGCCCGCAGGTA...CAGAAGGAGCAGATGACATTCC

    600     .    :    .    :    .    :    .    :    .    :
    574 TGGGCCAGTGACCTGGGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274346 TGGGCCAGTGACCTGGGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGT

    650     .    :    .    :    .    :    .    :    .    :
    624 GGCCGGAACCTGAGAATCCCAATGGATTGATTCTAATGTATGAAATAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274396 GGCCGGAACCTGAGAATCCCAATGGATTGATTCTAATGTATGAAATAAAA

    700     .    :    .    :    .    :    .    :    .
    674 TACGGATCACAAGTTGAG         GATCAGCGAGAATGTGTGT
        ||||||||||||||||||>>>...>>>|||||||||||||||||||
 274446 TACGGATCACAAGTTGAGGTA...CAGGATCAGCGAGAATGTGTGT

END