Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: H49376.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/H49376.1, 481 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|989217|gb|H49376.1|H49376 yq19a08.s1 Soares fetal liver spleen 1NFLS Homo sapiens cDNA clone IMAGE:274071 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

1-310  (3-312)   98% <-
311-481  (17255-17421)   95%

      0     .    :    .    :    .    :    .    :    .    :
      1 NNTCNTTAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCA
          ||  ||||||||||||||||||||||||||||||||||||||||||||
      3 TTTCTATAGAACATTATTGATAAAAGATCAACAGCAATCTACCAACTCCA

     50     .    :    .    :    .    :    .    :    .    :
     51 GGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     53 GGACCATTTTTGCAAGGTGCAAATCACTCCTAAAGACAATGTTGGAATGT

    100     .    :    .    :    .    :    .    :    .    :
    101 TTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    103 TTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAATGTTATCAA

    150     .    :    .    :    .    :    .    :    .    :
    151 ACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    153 ACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACTCGTGCAGAG

    200     .    :    .    :    .    :    .    :    .    :
    201 CAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    203 CAAAGGATCCTGCGGTGGCATGTCACTCTTCACTCCTCAGGAGGGTCTTC

    250     .    :    .    :    .    :    .    :    .    :
    251 CTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    253 CTACATCCTGTAGTTCTTGTTTCCTGCACTCCCTCTACTTGCGTTCTTCA

    300     .    :    .    :    .    :    .    :    .    :
    301 AATGTACTTC         CNTCTGGGTCTTGGGGCATGTCGGTGTGGCG
        ||||||||||<<<...<<<| ||||||||||-||||||||||||||||||
    303 AATGTACTTCCTA...TACCTTCTGGGTCTT GGGCATGTCGGTGTGGCG

    350     .    :    .    :    .    :    .    :    .    :
    342 CTGGGCACGGACAGAGCGAGCTGACTTGGGCAGGCTTGAGGGGGTGCGCA
        |||||||||||||||||||||||||||||-|||||||||||||-||||||
  17285 CTGGGCACGGACAGAGCGAGCTGACTTGG CAGGCTTGAGGGG TGCGCA

    400     .    :    .    :    .    :    .    :    .    :
    392 ATACATCTCCAGCCTCCTTAGATTCACAGCTCCGGAAGCAGCANTCATCC
        |||||||||||||||||||||||-||||||||||||||||||| ||||||
  17333 ATACATCTCCAGCCTCCTTAGAT CACAGCTCCGGAAGCAGCACTCATCC

    450     .    :    .    :    .    :    .    :
    442 ACGATGCCTGTTTGAGGCGCCCTCCGACTTCTGGAGCCAT
        ||||||||||| ||||||||||||||||| ||||||||||
  17382 ACGATGCCTGTCTGAGGCGCCCTCCGACTGCTGGAGCCAT

END