Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: J03503.1
Subject Sequence ID: ENSG00000131828
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/J03503.1, 1446 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000131828 (ENSG00000131828), 15915 bp

>gi|189765|gb|J03503.1|HUMPDHE1B Human pyruvate dehydrogenase E1-alpha subunit mRNA, cds
>ENSG00000131828

1-129  (34-162)   100% ->
130-189  (5380-5439)   100% ->
190-363  (6005-6178)   100% ->
364-490  (7349-7475)   100% ->
491-582  (9150-9241)   100% ->
583-675  (10559-10651)   100% ->
676-831  (11417-11572)   100% ->
832-903  (11754-11825)   100% ->
904-971  (13720-13787)   100% ->
972-1080  (14984-15092)   100% ->
1081-1439  (15557-15915)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     34 GAGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCG

     50     .    :    .    :    .    :    .    :    .    :
     51 CTGCCGCCACTGCCTGTGCTTCATGAGGAAGATGCTCGCCGCCGTCTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     84 CTGCCGCCACTGCCTGTGCTTCATGAGGAAGATGCTCGCCGCCGTCTCCC

    100     .    :    .    :    .    :    .    :    .    :
    101 GCGTGCTGTCTGGCGCTTCTCAGAAGCCG         GCAAGCAGAGTG
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
    134 GCGTGCTGTCTGGCGCTTCTCAGAAGCCGGTG...AAGGCAAGCAGAGTG

    150     .    :    .    :    .    :    .    :    .    :
    142 CTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATTAAG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
   5392 CTGGTAGCATCCCGTAATTTTGCAAATGATGCTACATTTGAAATTAAGGT

    200     .    :    .    :    .    :    .    :    .    :
    190        AAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCACAA
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
   5442 A...CAGAAATGTGACCTTCACCGGCTGGAAGAAGGCCCTCCTGTCACAA

    250     .    :    .    :    .    :    .    :    .    :
    233 CAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGCAGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6048 CAGTGCTCACCAGGGAGGATGGGCTCAAATACTACAGGATGATGCAGACT

    300     .    :    .    :    .    :    .    :    .    :
    283 GTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAAATTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6098 GTACGCCGAATGGAGTTGAAAGCAGATCAGCTGTATAAACAGAAAATTAT

    350     .    :    .    :    .    :    .    :    .    :
    333 TCGTGGTTTCTGTCACTTGTGTGATGGTCAG         GAAGCTTGCT
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   6148 TCGTGGTTTCTGTCACTTGTGTGATGGTCAGGTG...CAGGAAGCTTGCT

    400     .    :    .    :    .    :    .    :    .    :
    374 GTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCACAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7359 GTGTGGGCCTGGAGGCCGGCATCAACCCCACAGACCATCTCATCACAGCC

    450     .    :    .    :    .    :    .    :    .    :
    424 TACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAGAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7409 TACCGGGCTCACGGCTTTACTTTCACCCGGGGCCTTTCCGTCCGAGAAAT

    500     .    :    .    :    .    :    .    :    .    :
    474 TCTCGCAGAGCTTACAG         GACGAAAAGGAGGTTGTGCTAAAG
        |||||||||||||||||>>>...>>>||||||||||||||||||||||||
   7459 TCTCGCAGAGCTTACAGGTT...CAGGACGAAAAGGAGGTTGTGCTAAAG

    550     .    :    .    :    .    :    .    :    .    :
    515 GGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGGGCAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9174 GGAAAGGAGGATCGATGCACATGTATGCCAAGAACTTCTACGGGGGCAAT

    600     .    :    .    :    .    :    .    :    .    :
    565 GGCATCGTGGGAGCGCAG         GTGCCCCTGGGCGCTGGGATTGC
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
   9224 GGCATCGTGGGAGCGCAGGTA...TAGGTGCCCCTGGGCGCTGGGATTGC

    650     .    :    .    :    .    :    .    :    .    :
    606 TCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10582 TCTAGCCTGTAAGTATAATGGAAAAGATGAGGTCTGCCTGACTTTATATG

    700     .    :    .    :    .    :    .    :    .    :
    656 GCGATGGTGCTGCTAACCAG         GGCCAGATATTCGAAGCTTAC
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  10632 GCGATGGTGCTGCTAACCAGGTA...CAGGGCCAGATATTCGAAGCTTAC

    750     .    :    .    :    .    :    .    :    .    :
    697 AACATGGCAGCTTTGTGGAAATTACCTTGTATTTTCATCTGTGAGAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11438 AACATGGCAGCTTTGTGGAAATTACCTTGTATTTTCATCTGTGAGAATAA

    800     .    :    .    :    .    :    .    :    .    :
    747 TCGCTATGGAATGGGAACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11488 TCGCTATGGAATGGGAACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATT

    850     .    :    .    :    .    :    .    :    .    :
    797 ACTACAAGAGAGGCGATTTCATTCCTGGGCTGAGA         GTGGAT
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
  11538 ACTACAAGAGAGGCGATTTCATTCCTGGGCTGAGAGTA...CAGGTGGAT

    900     .    :    .    :    .    :    .    :    .    :
    838 GGAATGGATATCCTGTGCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11760 GGAATGGATATCCTGTGCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTA

    950     .    :    .    :    .    :    .    :    .    :
    888 TTGTAGATCTGGGAAG         GGGCCCATCCTGATGGAGCTGCAGA
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
  11810 TTGTAGATCTGGGAAGGTA...TAGGGGCCCATCCTGATGGAGCTGCAGA

   1000     .    :    .    :    .    :    .    :    .    :
    929 CTTACCGTTACCACGGACACAGTATGAGTGACCCTGGAGTCAG       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
  13745 CTTACCGTTACCACGGACACAGTATGAGTGACCCTGGAGTCAGGTA...T

   1050     .    :    .    :    .    :    .    :    .    :
    972   TTACCGTACACGAGAAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCC
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  14982 AGTTACCGTACACGAGAAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCC

   1100     .    :    .    :    .    :    .    :    .    :
   1020 TATTATGCTTCTCAAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15032 TATTATGCTTCTCAAGGACAGGATGGTGAACAGCAATCTTGCCAGTGTGG

   1150     .    :    .    :    .    :    .    :    .    :
   1070 AAGAACTAAAG         GAAATTGATGTGGAAGTGAGGAAGGAGATT
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  15082 AAGAACTAAAGGTA...TAGGAAATTGATGTGGAAGTGAGGAAGGAGATT

   1200     .    :    .    :    .    :    .    :    .    :
   1111 GAGGATCCTGCCCAGTTTGCCGCGGCCGATCCTGAGCCACCTTTGGAAGA
        |||||| |||||||||||||| ||||||||||||||||||||||||||||
  15587 GAGGATGCTGCCCAGTTTGCCACGGCCGATCCTGAGCCACCTTTGGAAGA

   1250     .    :    .    :    .    :    .    :    .    :
   1161 GCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCGTGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15637 GCTGGGCTACCACATCTACTCCAGCGACCCACCTTTTGAAGTTCGTGGTG

   1300     .    :    .    :    .    :    .    :    .    :
   1211 CCAATCAGTGGATCAAGTTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15687 CCAATCAGTGGATCAAGTTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAG

   1350     .    :    .    :    .    :    .    :    .    :
   1261 AGGTTATACCTTCAGGGGGCTACCAGACAGTGTTCTCAACTTGGTTAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15737 AGGTTATACCTTCAGGGGGCTACCAGACAGTGTTCTCAACTTGGTTAAGG

   1400     .    :    .    :    .    :    .    :    .    :
   1311 AGGAAGAAAACCCAGTCAATGAAATTCAATGAAATTCTTGGAAACTTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15787 AGGAAGAAAACCCAGTCAATGAAATTCAATGAAATTCTTGGAAACTTCCA

   1450     .    :    .    :    .    :    .    :    .    :
   1361 TTAAGTGTGTAGATTGAGCAGGTAGTAATTGCATGCAGTTTGTACATTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15837 TTAAGTGTGTAGATTGAGCAGGTAGTAATTGCATGCAGTTTGTACATTAG

   1500     .    :    .    :    .
   1411 TGCATTAAAAGATGAATTATTGAGTGCTT
        |||||||||||||||||||||||||||||
  15887 TGCATTAAAAGATGAATTATTGAGTGCTT

END