Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: L48690.1
Subject Sequence ID: ENSG00000131828
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/L48690.1, 1492 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000131828 (ENSG00000131828), 15915 bp

>gi|1051096|gb|L48690.1|HUMPDHA1G Homo sapiens pyruvate dehydrogenase E1-alpha subunit precursor (PDHA1) mRNA, complete cds
>ENSG00000131828

1-162  (1-162)   98% ->
163-222  (5380-5439)   100% ->
223-396  (6005-6178)   100% ->
397-522  (7349-7475)   98% ->
523-614  (9150-9241)   100% ->
615-708  (10559-10651)   98% ->
709-864  (11417-11572)   100% ->
865-936  (11754-11825)   100% ->
937-1004  (13720-13787)   100% ->
1005-1113  (14984-15092)   100% ->
1114-1472  (15557-15915)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC

     50     .    :    .    :    .    :    .    :    .    :
     51 CCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT
         |||||||||||||||||||||||||||||||||||||||||||||||||
     51 GCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT

    100     .    :    .    :    .    :    .    :    .    :
    101 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCCCGTGCTGTCTGGCGCT
        ||||||||||||||||||||||||||||||||| ||||||||||||||||
    101 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCT

    150     .    :    .    :    .    :    .    :    .    :
    151 TCTCAGAAGCCG         GCAAGCAGAGTGCTGGTAGCATCCCGTAA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
    151 TCTCAGAAGCCGGTG...AAGGCAAGCAGAGTGCTGGTAGCATCCCGTAA

    200     .    :    .    :    .    :    .    :    .    :
    192 TTTTGCAAATGATGCTACATTTGAAATTAAG         AAATGTGACC
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   5409 TTTTGCAAATGATGCTACATTTGAAATTAAGGTA...CAGAAATGTGACC

    250     .    :    .    :    .    :    .    :    .    :
    233 TTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6015 TTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAG

    300     .    :    .    :    .    :    .    :    .    :
    283 GATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6065 GATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTT

    350     .    :    .    :    .    :    .    :    .    :
    333 GAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6115 GAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACT

    400     .    :    .    :    .    :    .    :    .    :
    383 TGTGTGATGGTCAG         GAAGCTTGCTGTGTGGGCCTGGA GCG
        ||||||||||||||>>>...>>>|||||||||||||||||||||||-|| 
   6165 TGTGTGATGGTCAGGTG...CAGGAAGCTTGCTGTGTGGGCCTGGAGGCC

    450     .    :    .    :    .    :    .    :    .    :
    423 GGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7376 GGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTT

    500     .    :    .    :    .    :    .    :    .    :
    473 TACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7426 TACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAG

    550     .    :    .    :    .    :    .    :    .    :
    523          GACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATG
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
   7476 GTT...CAGGACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATG

    600     .    :    .    :    .    :    .    :    .    :
    564 CACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9191 CACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCA

    650     .    :    .    :    .    :    .    :    .    :
    614 G         GTGCCCCTGGGCTGCTGGGATTGCTCTAGCCTGTAAGTAT
        |>>>...>>>||||||||||||-|||||||||||||||||||||||||||
   9241 GGTA...TAGGTGCCCCTGGGC GCTGGGATTGCTCTAGCCTGTAAGTAT

    700     .    :    .    :    .    :    .    :    .    :
    655 AATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10598 AATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAA

    750     .    :    .    :    .    :    .    :    .    :
    705 CCAG         GGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGT
        ||||>>>...>>>|||||||||||||||||||||||||||||||||||||
  10648 CCAGGTA...CAGGGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGT

    800     .    :    .    :    .    :    .    :    .    :
    746 GGAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11454 GGAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGA

    850     .    :    .    :    .    :    .    :    .    :
    796 ACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11504 ACGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGA

    900     .    :    .    :    .    :    .    :    .    :
    846 TTTCATTCCTGGGCTGAGA         GTGGATGGAATGGATATCCTGT
        |||||||||||||||||||>>>...>>>||||||||||||||||||||||
  11554 TTTCATTCCTGGGCTGAGAGTA...CAGGTGGATGGAATGGATATCCTGT

    950     .    :    .    :    .    :    .    :    .    :
    887 GCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11776 GCGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAG

   1000     .    :    .    :    .    :    .    :    .    :
    937          GGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGG
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  11826 GTA...TAGGGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGG

   1050     .    :    .    :    .    :    .    :    .    :
    978 ACACAGTATGAGTGACCCTGGAGTCAG         TTACCGTACACGAG
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  13761 ACACAGTATGAGTGACCCTGGAGTCAGGTA...TAGTTACCGTACACGAG

   1100     .    :    .    :    .    :    .    :    .    :
   1019 AAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  14998 AAGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAG

   1150     .    :    .    :    .    :    .    :    .    :
   1069 GACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
  15048 GACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGTA..

   1200     .    :    .    :    .    :    .    :    .    :
   1114     GAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGT
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
  15098 .TAGGAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGT

   1250     .    :    .    :    .    :    .    :    .    :
   1160 TTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15603 TTGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATC

   1300     .    :    .    :    .    :    .    :    .    :
   1210 TACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15653 TACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAA

   1350     .    :    .    :    .    :    .    :    .    :
   1260 GTTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAGAGGTTATACCTTCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15703 GTTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAGAGGTTATACCTTCAGG

   1400     .    :    .    :    .    :    .    :    .    :
   1310 GGGCTACCAGACAGTGTTCTCAACTTGGTTAAGGAGGAAGAAAACCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15753 GGGCTACCAGACAGTGTTCTCAACTTGGTTAAGGAGGAAGAAAACCCAGT

   1450     .    :    .    :    .    :    .    :    .    :
   1360 CAATGAAATTCAATGAAATTCTTGGAAACTTCCATTAAGTGTGTAGATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15803 CAATGAAATTCAATGAAATTCTTGGAAACTTCCATTAAGTGTGTAGATTG

   1500     .    :    .    :    .    :    .    :    .    :
   1410 AGCAGGTAGCAATTGCATGCAGTTTGTACATTACTGCATTAAAAGATGAA
        ||||||||| ||||||||||||||||||||||| ||||||||||||||||
  15853 AGCAGGTAGTAATTGCATGCAGTTTGTACATTAGTGCATTAAAAGATGAA

   1550     .    :
   1460 TTAATGAGTGCTT
        ||| |||||||||
  15903 TTATTGAGTGCTT

END