Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: M83312.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/web_temp/fasta/M83312.1, 1579 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|1553058|gb|M83312.1|MUSCD40A Mouse CD40 mRNA, complete cds
>ENSG00000101017

114-139  (3608-3633)   92% ==
441-467  (4889-4915)   100% ==
737-846  (10666-10774)   83%

      0     .    :    .    :    .
    114 CAGTGCTGTGATTTGTGCCAGCCAGG
        |||||||||  |||||||||||||||
   3608 CAGTGCTGTTCTTTGTGCCAGCCAGG

      0     .    :    .    :    .
    441 CCCTGCCCAGTCGGCTTCTTCTCCAAT
        |||||||||||||||||||||||||||
   4889 CCCTGCCCAGTCGGCTTCTTCTCCAAT

      0     .    :    .    :    .    :    .    :    .    :
    737 TCCCGG TCATAACACCGCTGCTCCAGTGCAGGAGACACTGCACGGGTGT
        ||| ||-|| -||||| ||||||||||||||||||||  | || || || 
  10666 TCCTGGCTCC AACACTGCTGCTCCAGTGCAGGAGACTTTACATGGATGC

     50     .    :    .    :    .    :    .    :    .    :
    786 CAGCCTGTCACACAGGAGGATGGTAAAGAGAGTCGCATCTCAGTGCAGGA
        || || ||||| ||||||||||| ||||||||||||||||||||||||||
  10715 CAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAGGA

    100     .    :
    836 GCGGCAGGTGA
        | | |||-|||
  10765 GAGACAG TGA

END