Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: N49117.1
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/N49117.1, 393 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|1190283|gb|N49117.1|N49117 yy79a11.r1 Soares_multiple_sclerosis_2NbHMSP Homo sapiens cDNA clone IMAGE:279740 5' similar to gb:M28668 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR (HUMAN);, mRNA sequence
>ENSG00000001626

1-393  (187914-188290)   94%

      0     .    :    .    :    .    :    .    :    .    :
      1 GAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187914 GAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACC

     50     .    :    .    :    .    :    .    :    .    :
     51 TTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187964 TTTGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGG

    100     .    :    .    :    .    :    .    :    .    :
    101 ACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188014 ACAGCCCTTCTTTCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATA

    150     .    :    .    :    .    :    .    :    .    :
    151 GGCCATGG NACCTGTGGGTAGACACACATGAAGTCCAAGCATTTAGATG
        ||||||||- ||-|||||||||||||||||||||||||||||||||||||
 188064 GGCCATGGGCAC TGTGGGTAGACACACATGAAGTCCAAGCATTTAGATG

    200     .    :    .    :    .    :    .    :    .    :
    200 TATAGGTTGATGGTGGTATGTTTTTCAGNCTAGATGTATGTACTTCATGC
        ||||||||||||||||||||||||-||| |||||||||||||||||||||
 188113 TATAGGTTGATGGTGGTATGTTTT CAGGCTAGATGTATGTACTTCATGC

    250     .    :    .    :    .    :    .    :    .    :
    250 TGTCTACACTAAGAGAGGAATGAGAGACACACTGNAAGAAGCACCAATCA
        |||||||||||||||||-||||||||||||||||-|||||||||||||||
 188162 TGTCTACACTAAGAGAG AATGAGAGACACACTG AAGAAGCACCAATCA

    300     .    :    .    :    .    :    .    :    .    :
    300 TGAATTAGTTTTATATGCTTCTGGTTTTANTAATTTTGTGGAAGCAAAAA
        |||||||||||||||||||||||-|||||-||||||||||-||||||||-
 188210 TGAATTAGTTTTATATGCTTCTG TTTTA TAATTTTGTG AAGCAAAA 

    350     .    :    .    :    .    :    .    :
    350 TTTTTTTNCTCCTAGGAAAATAATTTAATTTTTAATAATTGGTT
        -||||||-|||-||||-|||||-|||-|-||||||||||-|-||
 188256  TTTTTT CTC TAGG AAATA TTT A TTTTAATAAT G TT

END