Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: N79008.1
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 1


seq1 = /RAID/mart2/Splice/web_temp/fasta/N79008.1, 142 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|1241709|gb|N79008.1|N79008 zb42e10.s1 Soares_parathyroid_tumor_NbHPA Homo sapiens cDNA clone IMAGE:306282 3' similar to gb:X57025_rna1 INSULIN-LIKE GROWTH FACTOR IA PRECURSOR (HUMAN);, mRNA sequence
>ENSG00000017427

9-142  (94-228)   98%

      0     .    :    .    :    .    :    .    :    .    :
      9 TTTGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA
        || |||||||||||||||||||||||||||||||||||||||||||||||
     94 TTGGAATGTTTACTTGTGTATTTCATTGGGGGAAACGCCCATCTTTTAAA

     50     .    :    .    :    .    :    .    :    .    :
     59 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    144 TGTTATCAAACTTATTTTTTGGTAGGTGTTCCAAAGTTTAACAGGTAACT

    100     .    :    .    :    .    :    .
    109 CGTGCAGAG AAAGGATCCTGCGGTGGCATGTCAC
        |||||||||-|||||||||||||||||||||||||
    194 CGTGCAGAGCAAAGGATCCTGCGGTGGCATGTCAC

END