Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_000284.1
Subject Sequence ID: ENSG00000131828
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_000284.1, 1472 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000131828 (ENSG00000131828), 15915 bp

>gi|4505684|ref|NM_000284.1| Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), mRNA
>ENSG00000131828

1-162  (1-162)   100% ->
163-222  (5380-5439)   100% ->
223-396  (6005-6178)   100% ->
397-523  (7349-7475)   100% ->
524-615  (9150-9241)   100% ->
616-708  (10559-10651)   100% ->
709-864  (11417-11572)   100% ->
865-936  (11754-11825)   100% ->
937-1004  (13720-13787)   100% ->
1005-1113  (14984-15092)   100% ->
1114-1472  (15557-15915)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 ACTGAGGCGTGGCGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCC

     50     .    :    .    :    .    :    .    :    .    :
     51 GCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGT

    100     .    :    .    :    .    :    .    :    .    :
    101 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GCTTCATGAGGAAGATGCTCGCCGCCGTCTCCCGCGTGCTGTCTGGCGCT

    150     .    :    .    :    .    :    .    :    .    :
    151 TCTCAGAAGCCG         GCAAGCAGAGTGCTGGTAGCATCCCGTAA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
    151 TCTCAGAAGCCGGTG...AAGGCAAGCAGAGTGCTGGTAGCATCCCGTAA

    200     .    :    .    :    .    :    .    :    .    :
    192 TTTTGCAAATGATGCTACATTTGAAATTAAG         AAATGTGACC
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   5409 TTTTGCAAATGATGCTACATTTGAAATTAAGGTA...CAGAAATGTGACC

    250     .    :    .    :    .    :    .    :    .    :
    233 TTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6015 TTCACCGGCTGGAAGAAGGCCCTCCTGTCACAACAGTGCTCACCAGGGAG

    300     .    :    .    :    .    :    .    :    .    :
    283 GATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6065 GATGGGCTCAAATACTACAGGATGATGCAGACTGTACGCCGAATGGAGTT

    350     .    :    .    :    .    :    .    :    .    :
    333 GAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   6115 GAAAGCAGATCAGCTGTATAAACAGAAAATTATTCGTGGTTTCTGTCACT

    400     .    :    .    :    .    :    .    :    .    :
    383 TGTGTGATGGTCAG         GAAGCTTGCTGTGTGGGCCTGGAGGCC
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
   6165 TGTGTGATGGTCAGGTG...CAGGAAGCTTGCTGTGTGGGCCTGGAGGCC

    450     .    :    .    :    .    :    .    :    .    :
    424 GGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7376 GGCATCAACCCCACAGACCATCTCATCACAGCCTACCGGGCTCACGGCTT

    500     .    :    .    :    .    :    .    :    .    :
    474 TACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   7426 TACTTTCACCCGGGGCCTTTCCGTCCGAGAAATTCTCGCAGAGCTTACAG

    550     .    :    .    :    .    :    .    :    .    :
    524          GACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATG
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
   7476 GTT...CAGGACGAAAAGGAGGTTGTGCTAAAGGGAAAGGAGGATCGATG

    600     .    :    .    :    .    :    .    :    .    :
    565 CACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9191 CACATGTATGCCAAGAACTTCTACGGGGGCAATGGCATCGTGGGAGCGCA

    650     .    :    .    :    .    :    .    :    .    :
    615 G         GTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATA
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   9241 GGTA...TAGGTGCCCCTGGGCGCTGGGATTGCTCTAGCCTGTAAGTATA

    700     .    :    .    :    .    :    .    :    .    :
    656 ATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10599 ATGGAAAAGATGAGGTCTGCCTGACTTTATATGGCGATGGTGCTGCTAAC

    750     .    :    .    :    .    :    .    :    .    :
    706 CAG         GGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGTG
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  10649 CAGGTA...CAGGGCCAGATATTCGAAGCTTACAACATGGCAGCTTTGTG

    800     .    :    .    :    .    :    .    :    .    :
    747 GAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11455 GAAATTACCTTGTATTTTCATCTGTGAGAATAATCGCTATGGAATGGGAA

    850     .    :    .    :    .    :    .    :    .    :
    797 CGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  11505 CGTCTGTTGAGAGAGCGGCAGCCAGCACTGATTACTACAAGAGAGGCGAT

    900     .    :    .    :    .    :    .    :    .    :
    847 TTCATTCCTGGGCTGAGA         GTGGATGGAATGGATATCCTGTG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
  11555 TTCATTCCTGGGCTGAGAGTA...CAGGTGGATGGAATGGATATCCTGTG

    950     .    :    .    :    .    :    .    :    .    :
    888 CGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
  11777 CGTCCGAGAGGCAACAAGGTTTGCTGCTGCCTATTGTAGATCTGGGAAGG

   1000     .    :    .    :    .    :    .    :    .    :
    937         GGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGGA
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
  11827 TA...TAGGGGCCCATCCTGATGGAGCTGCAGACTTACCGTTACCACGGA

   1050     .    :    .    :    .    :    .    :    .    :
    979 CACAGTATGAGTGACCCTGGAGTCAG         TTACCGTACACGAGA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
  13762 CACAGTATGAGTGACCCTGGAGTCAGGTA...TAGTTACCGTACACGAGA

   1100     .    :    .    :    .    :    .    :    .    :
   1020 AGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  14999 AGAAATTCAGGAAGTAAGAAGTAAGAGTGACCCTATTATGCTTCTCAAGG

   1150     .    :    .    :    .    :    .    :    .    :
   1070 ACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
  15049 ACAGGATGGTGAACAGCAATCTTGCCAGTGTGGAAGAACTAAAGGTA...

   1200     .    :    .    :    .    :    .    :    .    :
   1114    GAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGTT
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
  15554 TAGGAAATTGATGTGGAAGTGAGGAAGGAGATTGAGGATGCTGCCCAGTT

   1250     .    :    .    :    .    :    .    :    .    :
   1161 TGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15604 TGCCACGGCCGATCCTGAGCCACCTTTGGAAGAGCTGGGCTACCACATCT

   1300     .    :    .    :    .    :    .    :    .    :
   1211 ACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15654 ACTCCAGCGACCCACCTTTTGAAGTTCGTGGTGCCAATCAGTGGATCAAG

   1350     .    :    .    :    .    :    .    :    .    :
   1261 TTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAGAGGTTATACCTTCAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15704 TTTAAGTCAGTCAGTTAAGGGGAGGAGAAGGAGAGGTTATACCTTCAGGG

   1400     .    :    .    :    .    :    .    :    .    :
   1311 GGCTACCAGACAGTGTTCTCAACTTGGTTAAGGAGGAAGAAAACCCAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15754 GGCTACCAGACAGTGTTCTCAACTTGGTTAAGGAGGAAGAAAACCCAGTC

   1450     .    :    .    :    .    :    .    :    .    :
   1361 AATGAAATTCAATGAAATTCTTGGAAACTTCCATTAAGTGTGTAGATTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15804 AATGAAATTCAATGAAATTCTTGGAAACTTCCATTAAGTGTGTAGATTGA

   1500     .    :    .    :    .    :    .    :    .    :
   1411 GCAGGTAGTAATTGCATGCAGTTTGTACATTAGTGCATTAAAAGATGAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  15854 GCAGGTAGTAATTGCATGCAGTTTGTACATTAGTGCATTAAAAGATGAAT

   1550     .    :
   1461 TATTGAGTGCTT
        ||||||||||||
  15904 TATTGAGTGCTT

END