Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_000492.2
Subject Sequence ID: ENSG00000001626
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_000492.2, 6129 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000001626 (ENSG00000001626), 188699 bp

>gi|6995995|ref|NM_000492.2| Homo sapiens cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7) (CFTR), mRNA
>ENSG00000001626

1-185  (1-185)   100% ->
186-296  (24291-24401)   100% ->
297-405  (29072-29180)   100% ->
406-621  (50937-51152)   100% ->
622-711  (54314-54403)   100% ->
712-875  (55286-55449)   100% ->
876-1001  (56586-56711)   100% ->
1002-1248  (60138-60384)   100% ->
1249-1341  (62054-62146)   100% ->
1342-1524  (68679-68861)   100% ->
1525-1716  (79502-79693)   99% ->
1717-1811  (107777-107871)   100% ->
1812-1898  (110391-110477)   100% ->
1899-2622  (111972-112695)   99% ->
2623-2751  (114968-115096)   99% ->
2752-2789  (122864-122901)   100% ->
2790-3040  (123570-123820)   100% ->
3041-3120  (126712-126791)   100% ->
3121-3271  (130557-130707)   100% ->
3272-3499  (131619-131846)   100% ->
3500-3600  (134651-134751)   100% ->
3601-3849  (147560-147808)   100% ->
3850-4005  (162476-162631)   100% ->
4006-4095  (172880-172969)   100% ->
4096-4268  (184726-184898)   100% ->
4269-4374  (185497-185602)   100% ->
4375-6129  (186946-188699)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGG

     50     .    :    .    :    .    :    .    :    .    :
     51 CAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 CAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACG

    100     .    :    .    :    .    :    .    :    .    :
    101 GCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    101 GCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTG

    150     .    :    .    :    .    :    .    :    .    :
    151 GAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAG         CTGGAC
        |||||||||||||||||||||||||||||||||||>>>...>>>||||||
    151 GAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGGTG...TAGCTGGAC

    200     .    :    .    :    .    :    .    :    .    :
    192 CAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24297 CAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACA

    250     .    :    .    :    .    :    .    :    .    :
    242 TATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  24347 TATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTG

    300     .    :    .    :    .    :    .    :    .    :
    292 GAAAG         AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCC
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  24397 GAAAGGTA...CAGAGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCC

    350     .    :    .    :    .    :    .    :    .    :
    333 TAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  29108 TAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCT

    400     .    :    .    :    .    :    .    :    .    :
    383 ATGGAATCTTTTTATATTTAGGG         GAAGTCACCAAAGCAGTA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
  29158 ATGGAATCTTTTTATATTTAGGGGTA...TAGGAAGTCACCAAAGCAGTA

    450     .    :    .    :    .    :    .    :    .    :
    424 CAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50955 CAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAA

    500     .    :    .    :    .    :    .    :    .    :
    474 GGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51005 GGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCT

    550     .    :    .    :    .    :    .    :    .    :
    524 TTATTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  51055 TTATTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCAC

    600     .    :    .    :    .    :    .    :    .    :
    574 ATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
  51105 ATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAGGT

    650     .    :    .    :    .    :    .    :    .    :
    622        ACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTG
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
  51155 A...TAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTG

    700     .    :    .    :    .    :    .    :    .    :
    665 GACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAA   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
  54357 GACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATGAAGTA

    750     .    :    .    :    .    :    .    :    .    :
    712       GGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGT
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  54407 ...CAGGGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGT

    800     .    :    .    :    .    :    .    :    .    :
    756 GGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  55330 GGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCT

    850     .    :    .    :    .    :    .    :    .    :
    806 GTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTAGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  55380 GTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTAGGG

    900     .    :    .    :    .    :    .    :    .    :
    856 AGAATGATGATGAAGTACAG         AGATCAGAGAGCTGGGAAGAT
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
  55430 AGAATGATGATGAAGTACAGGTA...CAGAGATCAGAGAGCTGGGAAGAT

    950     .    :    .    :    .    :    .    :    .    :
    897 CAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  56607 CAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTG

   1000     .    :    .    :    .    :    .    :    .    :
    947 TTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  56657 TTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTA

   1050     .    :    .    :    .    :    .    :    .    :
    997 AGACA         AACAGAACTGAAACTGACTCGGAAGGCAGCCTATGT
        |||||>>>...>>>||||||||||||||||||||||||||||||||||||
  56707 AGACAGTA...TAGAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGT

   1100     .    :    .    :    .    :    .    :    .    :
   1038 GAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60174 GAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGT

   1150     .    :    .    :    .    :    .    :    .    :
   1088 TTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60224 TTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAA

   1200     .    :    .    :    .    :    .    :    .    :
   1138 ATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60274 ATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCG

   1250     .    :    .    :    .    :    .    :    .    :
   1188 GCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60324 GCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAA

   1300     .    :    .    :    .    :    .    :    .    :
   1238 ACAAAATACAG         GATTTCTTACAAAAGCAAGAATATAAGACA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
  60374 ACAAAATACAGGTA...TAGGATTTCTTACAAAAGCAAGAATATAAGACA

   1350     .    :    .    :    .    :    .    :    .    :
   1279 TTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  62084 TTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGC

   1400     .    :    .    :    .    :    .    :    .    :
   1329 CTTCTGGGAGGAG         GGATTTGGGGAATTATTTGAGAAAGCAA
        |||||||||||||>>>...>>>||||||||||||||||||||||||||||
  62134 CTTCTGGGAGGAGGTC...CAGGGATTTGGGGAATTATTTGAGAAAGCAA

   1450     .    :    .    :    .    :    .    :    .    :
   1370 AACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68707 AACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTC

   1500     .    :    .    :    .    :    .    :    .    :
   1420 TTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68757 TTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTT

   1550     .    :    .    :    .    :    .    :    .    :
   1470 CAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68807 CAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAG

   1600     .    :    .    :    .    :    .    :    .    :
   1520 GCAAG         ACTTCACTTCTAATGATGATTATGGGAGAACTGGAG
        |||||>>>...>>>||||||||||||||| ||||||||||||||||||||
  68857 GCAAGGTA...CAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAG

   1650     .    :    .    :    .    :    .    :    .    :
   1561 CCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79538 CCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCA

   1700     .    :    .    :    .    :    .    :    .    :
   1611 GTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79588 GTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTG

   1750     .    :    .    :    .    :    .    :    .    :
   1661 TTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79638 TTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTA

   1800     .    :    .    :    .    :    .    :    .    :
   1711 GAAGAG         GACATCTCCAAGTTTGCAGAGAAAGACAATATAGT
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  79688 GAAGAGGTA...TAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGT

   1850     .    :    .    :    .    :    .    :    .    :
   1752 TCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 107812 TCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT

   1900     .    :    .    :    .    :    .    :    .    :
   1802 CTTTAGCAAG         AGCAGTATACAAAGATGCTGATTTGTATTTA
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
 107862 CTTTAGCAAGGTG...TAGAGCAGTATACAAAGATGCTGATTTGTATTTA

   1950     .    :    .    :    .    :    .    :    .    :
   1843 TTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 110422 TTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATT

   2000     .    :    .    :    .    :    .    :    .    :
   1893 TGAAAG         CTGTGTCTGTAAACTGATGGCTAACAAAACTAGGA
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
 110472 TGAAAGGTA...AAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAGGA

   2050     .    :    .    :    .    :    .    :    .    :
   1934 TTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112007 TTTTGGTCACTTCTAAAATGGAACATTTAAAGAAAGCTGACAAAATATTA

   2100     .    :    .    :    .    :    .    :    .    :
   1984 ATTTTGAATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCA
        |||||| |||||||||||||||||||||||||||||||||||||||||||
 112057 ATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCA

   2150     .    :    .    :    .    :    .    :    .    :
   2034 AAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112107 AAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCG

   2200     .    :    .    :    .    :    .    :    .    :
   2084 ACCAATTTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112157 ACCAATTTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACAC

   2250     .    :    .    :    .    :    .    :    .    :
   2134 CGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112207 CGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAA

   2300     .    :    .    :    .    :    .    :    .    :
   2184 ACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112257 ACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTA

   2350     .    :    .    :    .    :    .    :    .    :
   2234 TTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112307 TTCTCAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACT

   2400     .    :    .    :    .    :    .    :    .    :
   2284 CCCTTACAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112357 CCCTTACAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAG

   2450     .    :    .    :    .    :    .    :    .    :
   2334 AAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112407 AAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTC

   2500     .    :    .    :    .    :    .    :    .    :
   2384 GCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112457 GCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAG

   2550     .    :    .    :    .    :    .    :    .    :
   2434 TCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112507 TCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCA

   2600     .    :    .    :    .    :    .    :    .    :
   2484 CCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112557 CCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA

   2650     .    :    .    :    .    :    .    :    .    :
   2534 ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 112607 ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGC

   2700     .    :    .    :    .    :    .    :    .    :
   2584 TTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAG         GA
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 112657 TTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGTA...CAGGA

   2750     .    :    .    :    .    :    .    :    .    :
   2625 GTGCCTTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACA
        |||| |||||||||||||||||||||||||||||||||||||||||||||
 114970 GTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACA

   2800     .    :    .    :    .    :    .    :    .    :
   2675 CATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 115020 CATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATT

   2850     .    :    .    :    .    :    .    :    .    :
   2725 TGGTGCTTAGTAATTTTTCTGGCAGAG         GTGGCTGCTTCTTT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
 115070 TGGTGCTTAGTAATTTTTCTGGCAGAGGTA...CAGGTGGCTGCTTCTTT

   2900     .    :    .    :    .    :    .    :    .    :
   2766 GGTTGTGCTGTGGCTCCTTGGAAA         CACTCCTCTTCAAGACA
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
 122878 GGTTGTGCTGTGGCTCCTTGGAAAGTG...CAGCACTCCTCTTCAAGACA

   2950     .    :    .    :    .    :    .    :    .    :
   2807 AAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123587 AAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACC

   3000     .    :    .    :    .    :    .    :    .    :
   2857 AGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123637 AGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACAC

   3050     .    :    .    :    .    :    .    :    .    :
   2907 TTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123687 TTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAA

   3100     .    :    .    :    .    :    .    :    .    :
   2957 TCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 123737 TCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAA

   3150     .    :    .    :    .    :    .    :    .    :
   3007 GCACCTATGTCAACCCTCAACACGTTGAAAGCAG         GTGGGAT
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 123787 GCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTA...TAGGTGGGAT

   3200     .    :    .    :    .    :    .    :    .    :
   3048 TCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 126719 TCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTC

   3250     .    :    .    :    .    :    .    :    .    :
   3098 TTACCATATTTGACTTCATCCAG         TTGTTATTAATTGTGATT
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 126769 TTACCATATTTGACTTCATCCAGGTA...CAGTTGTTATTAATTGTGATT

   3300     .    :    .    :    .    :    .    :    .    :
   3139 GGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 130575 GGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAAC

   3350     .    :    .    :    .    :    .    :    .    :
   3189 AGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 130625 AGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAA

   3400     .    :    .    :    .    :    .    :    .    :
   3239 CCTCACAGCAACTCAAACAACTGGAATCTGAAG         GCAGGAGT
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
 130675 CCTCACAGCAACTCAAACAACTGGAATCTGAAGGTA...CAGGCAGGAGT

   3450     .    :    .    :    .    :    .    :    .    :
   3280 CCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131627 CCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCG

   3500     .    :    .    :    .    :    .    :    .    :
   3330 TGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131677 TGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGA

   3550     .    :    .    :    .    :    .    :    .    :
   3380 ATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131727 ATTTACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTC

   3600     .    :    .    :    .    :    .    :    .    :
   3430 CAAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 131777 CAAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTT

   3650     .    :    .    :    .    :    .    :    .    :
   3480 CATTTCCATTTTAACAACAG         GAGAAGGAGAAGGAAGAGTTG
        ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
 131827 CATTTCCATTTTAACAACAGGTA...TAGGAGAAGGAGAAGGAAGAGTTG

   3700     .    :    .    :    .    :    .    :    .    :
   3521 GTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 134672 GTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCT

   3750     .    :    .    :    .    :    .    :    .    :
   3571 GTAAACTCCAGCATAGATGTGGATAGCTTG         ATGCGATCTGT
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
 134722 GTAAACTCCAGCATAGATGTGGATAGCTTGGTA...CAGATGCGATCTGT

   3800     .    :    .    :    .    :    .    :    .    :
   3612 GAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 147571 GAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACCA

   3850     .    :    .    :    .    :    .    :    .    :
   3662 AGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 147621 AGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATT

   3900     .    :    .    :    .    :    .    :    .    :
   3712 GAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 147671 GAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAAT

   3950     .    :    .    :    .    :    .    :    .    :
   3762 GACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 147721 GACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATAT

   4000     .    :    .    :    .    :    .    :    .    :
   3812 TAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGG         GTG
        ||||||||||||||||||||||||||||||||||||||>>>...>>>|||
 147771 TAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTG...TAGGTG

   4050     .    :    .    :    .    :    .    :    .    :
   3853 GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162479 GGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTT

   4100     .    :    .    :    .    :    .    :    .    :
   3903 TTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162529 TTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTT

   4150     .    :    .    :    .    :    .    :    .    :
   3953 GGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 162579 GGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCA

   4200     .    :    .    :    .    :    .    :    .    :
   4003 CAG         AAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTT
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 162629 CAGGTG...TAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTT

   4250     .    :    .    :    .    :    .    :    .    :
   4044 GGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 172918 GGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATG

   4300     .    :    .    :    .    :    .    :    .    :
   4094 AG         GTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAG
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
 172968 AGGTA...CAGGTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAG

   4350     .    :    .    :    .    :    .    :    .    :
   4135 CTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184765 CTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAA

   4400     .    :    .    :    .    :    .    :    .    :
   4185 GCAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 184815 GCAGTTGATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGC

   4450     .    :    .    :    .    :    .    :    .    :
   4235 TGCTTGATGAACCCAGTGCTCATTTGGATCCAGT         AACATAC
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 184865 TGCTTGATGAACCCAGTGCTCATTTGGATCCAGTGTG...TAGAACATAC

   4500     .    :    .    :    .    :    .    :    .    :
   4276 CAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 185504 CAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAAT

   4550     .    :    .    :    .    :    .    :    .    :
   4326 TCTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTG 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
 185554 TCTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGG

   4600     .    :    .    :    .    :    .    :    .    :
   4375         GTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAG
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
 185604 TG...TAGGTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAG

   4650     .    :    .    :    .    :    .    :    .    :
   4417 AAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCATCAGCCCCTCCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 186988 AAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCATCAGCCCCTCCGA

   4700     .    :    .    :    .    :    .    :    .    :
   4467 CAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187038 CAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGTCTAAGC

   4750     .    :    .    :    .    :    .    :    .    :
   4517 CCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187088 CCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACA

   4800     .    :    .    :    .    :    .    :    .    :
   4567 AGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187138 AGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGGAA

   4850     .    :    .    :    .    :    .    :    .    :
   4617 TTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187188 TTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGT

   4900     .    :    .    :    .    :    .    :    .    :
   4667 TACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187238 TACCTCTGCCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGA

   4950     .    :    .    :    .    :    .    :    .    :
   4717 AACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGATAAATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187288 AACATTTGGTAAGGGGAATTGAGGACACTGATATGGGTCTTGATAAATGG

   5000     .    :    .    :    .    :    .    :    .    :
   4767 CTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187338 CTTCCTGGCAATAGTCAAATTGTGTGAAAGGTACTTCAAATCCTTGAAGA

   5050     .    :    .    :    .    :    .    :    .    :
   4817 TTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187388 TTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAAACCCTTGCCATG

   5100     .    :    .    :    .    :    .    :    .    :
   4867 TGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187438 TGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGATCA

   5150     .    :    .    :    .    :    .    :    .    :
   4917 GCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187488 GCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGA

   5200     .    :    .    :    .    :    .    :    .    :
   4967 AATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187538 AATCATACTTCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAG

   5250     .    :    .    :    .    :    .    :    .    :
   5017 CGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187588 CGGTTTATATAAGCTTGTATTCCTTTTTCTCTCCTCTCCCCATGATGTTT

   5300     .    :    .    :    .    :    .    :    .    :
   5067 AGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187638 AGAAACACAACTATATTGTTTGCTAAGCATTCCAACTATCTCATTTCCAA

   5350     .    :    .    :    .    :    .    :    .    :
   5117 GCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATCAAAATATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187688 GCAAGTATTAGAATACCACAGGAACCACAAGACTGCACATCAAAATATGC

   5400     .    :    .    :    .    :    .    :    .    :
   5167 CCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187738 CCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCTGG

   5450     .    :    .    :    .    :    .    :    .    :
   5217 AAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187788 AAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGA

   5500     .    :    .    :    .    :    .    :    .    :
   5267 TAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187838 TAATCACAATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACA

   5550     .    :    .    :    .    :    .    :    .    :
   5317 GGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187888 GGGGACAGGATGGTTCCCTTGATGAAGAAGTTGATATGCCTTTTCCCAAC

   5600     .    :    .    :    .    :    .    :    .    :
   5367 TCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187938 TCCAGAAAGTGACAAGCTCACAGACCTTTGAACTAGAGTTTAGCTGGAAA

   5650     .    :    .    :    .    :    .    :    .    :
   5417 AGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 187988 AGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTTTCCACAGAAGCT

   5700     .    :    .    :    .    :    .    :    .    :
   5467 CCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188038 CCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGACA

   5750     .    :    .    :    .    :    .    :    .    :
   5517 CACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188088 CACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTC

   5800     .    :    .    :    .    :    .    :    .    :
   5567 AGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188138 AGGCTAGATGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAGA

   5850     .    :    .    :    .    :    .    :    .    :
   5617 CACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188188 CACACTGAAGAAGCACCAATCATGAATTAGTTTTATATGCTTCTGTTTTA

   5900     .    :    .    :    .    :    .    :    .    :
   5667 TAATTTTGTGAAGCAAAATTTTTTCTCTAGGAAATATTTATTTTAATAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188238 TAATTTTGTGAAGCAAAATTTTTTCTCTAGGAAATATTTATTTTAATAAT

   5950     .    :    .    :    .    :    .    :    .    :
   5717 GTTTCAAACATATATTACAATGCTGTATTTTAAAAGAATGATTATGAATT
        ||||||||||||||| ||||||||||||||||||||||||||||||||||
 188288 GTTTCAAACATATATAACAATGCTGTATTTTAAAAGAATGATTATGAATT

   6000     .    :    .    :    .    :    .    :    .    :
   5767 ACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188338 ACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGGCA

   6050     .    :    .    :    .    :    .    :    .    :
   5817 CTAGTATTTTTATGAAATATTATGTTAAAACTGGGACAGGGGAGAACCTA
        ||||||||| ||||||||||||||||||||||||||||||||||||||||
 188388 CTAGTATTTCTATGAAATATTATGTTAAAACTGGGACAGGGGAGAACCTA

   6100     .    :    .    :    .    :    .    :    .    :
   5867 GGGTGATATTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188438 GGGTGATATTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGC

   6150     .    :    .    :    .    :    .    :    .    :
   5917 CTTGGGGCTGAT CGAGTTGTTGCCCACAGCTGTATGATTCCCAGCCAGA
        ||||||||||||-|-||||||||||||||||||||||||||||||||||-
 188488 CTTGGGGCTGATGC AGTTGTTGCCCACAGCTGTATGATTCCCAGCCAG 

   6200     .    :    .    :    .    :    .    :    .    :
   5966 CACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188536 CACAGCCTCTTAGATGCAGTTCTGAAGAAGATGGTACCACCAGTCTGACT

   6250     .    :    .    :    .    :    .    :    .    :
   6016 GTTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188586 GTTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTGACTCTTAAGA

   6300     .    :    .    :    .    :    .    :    .    :
   6066 AGACTGCATTATATTTATTACTGTAAGAAAATATCACTTGTCAATAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 188636 AGACTGCATTATATTTATTACTGTAAGAAAATATCACTTGTCAATAAAAT

   6350     .    :
   6116 CCATACATTTGTGT
        ||||||||||||||
 188686 CCATACATTTGTGT

END