Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_000618.2
Subject Sequence ID: ENSG00000017427
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_000618.2, 7260 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000017427 (ENSG00000017427), 78292 bp

>gi|19923111|ref|NM_000618.2| Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1), mRNA
>ENSG00000017427

(complement)

1-229  (1-228)   99% ->
230-386  (4748-4904)   100% ->
387-568  (60857-61038)   100% ->
569-880  (77981-78292)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 TCACTGTCACTGCTAAATTCAGAGCAGATTAGAGCCTGCGCAATGGAATA
        ||||||||||||||||||||||||||||-|||||||||||||||||||||
      1 TCACTGTCACTGCTAAATTCAGAGCAGA TAGAGCCTGCGCAATGGAATA

     50     .    :    .    :    .    :    .    :    .    :
     51 AAGTCCTCAAAATTGAAATGTGACATTGCTCTCAACATCTCCCATCTCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     50 AAGTCCTCAAAATTGAAATGTGACATTGCTCTCAACATCTCCCATCTCTC

    100     .    :    .    :    .    :    .    :    .    :
    101 TGGATTTCCTTTTGCTTCATTATTCCTGCTAACCAATTCATTTTCAGACT
        |||||||| |||||||||||||||||||||||||||||||||||||||||
    100 TGGATTTCTTTTTGCTTCATTATTCCTGCTAACCAATTCATTTTCAGACT

    150     .    :    .    :    .    :    .    :    .    :
    151 TTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    150 TTGTACTTCAGAAGCAATGGGAAAAATCAGCAGTCTTCCAACCCAATTAT

    200     .    :    .    :    .    :    .    :    .    :
    201 TTAAGTGCTGCTTTTGTGATTTCTTGAAG         GTGAAGATGCAC
        |||||||||||||||||||||||||||||>>>...>>>||||||||||||
    200 TTAAGTGCTGCTTTTGTGATTTCTTGAAGGTA...CAGGTGAAGATGCAC

    250     .    :    .    :    .    :    .    :    .    :
    242 ACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4760 ACCATGTCCTCCTCGCATCTCTTCTACCTGGCGCTGTGCCTGCTCACCTT

    300     .    :    .    :    .    :    .    :    .    :
    292 CACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4810 CACCAGCTCTGCCACGGCTGGACCGGAGACGCTCTGCGGGGCTGAGCTGG

    350     .    :    .    :    .    :    .    :    .    :
    342 TGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCA     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
   4860 TGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAGTA..

    400     .    :    .    :    .    :    .    :    .    :
    387     ACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGAC
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
   4910 .CAGACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGAC

    450     .    :    .    :    .    :    .    :    .    :
    433 AGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60903 AGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGG

    500     .    :    .    :    .    :    .    :    .    :
    483 AGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  60953 AGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTCGCTCTGTCCGT

    550     .    :    .    :    .    :    .    :    .    :
    533 GCCCAGCGCCACACCGACATGCCCAAGACCCAGAAG         GAAGT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  61003 GCCCAGCGCCACACCGACATGCCCAAGACCCAGAAGGTA...TAGGAAGT

    600     .    :    .    :    .    :    .    :    .    :
    574 ACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77986 ACATTTGAAGAACGCAAGTAGAGGGAGTGCAGGAAACAAGAACTACAGGA

    650     .    :    .    :    .    :    .    :    .    :
    624 TGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78036 TGTAGGAAGACCCTCCTGAGGAGTGAAGAGTGACATGCCACCGCAGGATC

    700     .    :    .    :    .    :    .    :    .    :
    674 CTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78086 CTTTGCTCTGCACGAGTTACCTGTTAAACTTTGGAACACCTACCAAAAAA

    750     .    :    .    :    .    :    .    :    .    :
    724 TAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78136 TAAGTTTGATAACATTTAAAAGATGGGCGTTTCCCCCAATGAAATACACA

    800     .    :    .    :    .    :    .    :    .    :
    774 AGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78186 AGTAAACATTCCAACATTGTCTTTAGGAGTGATTTGCACCTTGCAAAAAT

    850     .    :    .    :    .    :    .    :    .    :
    824 GGTCCTGGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  78236 GGTCCTGGAGTTGGTAGATTGCTGTTGATCTTTTATCAATAATGTTCTAT

    900     .
    874 AGAAAAG
        |||||||
  78286 AGAAAAG

END