Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_000875.2
Subject Sequence ID: ENSG00000140443
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_000875.2, 4989 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000140443 (ENSG00000140443), 308733 bp

>gi|11068002|ref|NM_000875.2| Homo sapiens insulin-like growth factor 1 receptor (IGF1R), mRNA
>ENSG00000140443

15-139  (1-126)   99% ->
140-685  (58013-58558)   100% ->
686-998  (241776-242088)   100% ->
999-1147  (247208-247356)   100% ->
1148-1292  (249928-250072)   100% ->
1293-1507  (259136-259350)   100% ->
1508-1634  (261766-261892)   100% ->
1635-1873  (263495-263733)   100% ->
1874-2041  (266415-266582)   100% ->
2042-2246  (267123-267327)   100% ->
2247-2530  (272599-272882)   100% ->
2531-2667  (274327-274463)   100% ->
2668-2827  (274976-275135)   100% ->
2828-2930  (280009-280111)   100% ->
2931-3001  (280686-280756)   100% ->
3002-3231  (285275-285504)   100% ->
3232-3342  (285767-285877)   100% ->
3343-3502  (289652-289811)   100% ->
3503-3632  (293374-293503)   99% ->
3633-3767  (299025-299159)   100% ->
3768-4989  (307512-308733)   99%

      0     .    :    .    :    .    :    .    :    .    :
     15 GAGAAAGGG AATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA
        |||||||||-||||||||||||||||||||||||||||||||||||||||
      1 GAGAAAGGGGAATTTCATCCCAAATAAAAGGAATGAAGTCTGGCTCCGGA

     50     .    :    .    :    .    :    .    :    .    :
     64 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGAGGGTCCCCGACCTCGCTGTGGGGGCTCCTGTTTCTCTCCGCCGCGCT

    100     .    :    .    :    .    :    .    :    .    :
    114 CTCGCTCTGGCCGACGAGTGGAGAAA         TCTGCGGGCCAGGCA
        ||||||||||||||||||||||||||>>>...>>>|||||||||||||||
    101 CTCGCTCTGGCCGACGAGTGGAGAAAGTG...CAGTCTGCGGGCCAGGCA

    150     .    :    .    :    .    :    .    :    .    :
    155 TCGACATCCGCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58028 TCGACATCCGCAACGACTATCAGCAGCTGAAGCGCCTGGAGAACTGCACG

    200     .    :    .    :    .    :    .    :    .    :
    205 GTGATCGAGGGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58078 GTGATCGAGGGCTACCTCCACATCCTGCTCATCTCCAAGGCCGAGGACTA

    250     .    :    .    :    .    :    .    :    .    :
    255 CCGCAGCTACCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58128 CCGCAGCTACCGCTTCCCCAAGCTCACGGTCATTACCGAGTACTTGCTGC

    300     .    :    .    :    .    :    .    :    .    :
    305 TGTTCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58178 TGTTCCGAGTGGCTGGCCTCGAGAGCCTCGGAGACCTCTTCCCCAACCTC

    350     .    :    .    :    .    :    .    :    .    :
    355 ACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58228 ACGGTCATCCGCGGCTGGAAACTCTTCTACAACTACGCCCTGGTCATCTT

    400     .    :    .    :    .    :    .    :    .    :
    405 CGAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58278 CGAGATGACCAATCTCAAGGATATTGGGCTTTACAACCTGAGGAACATTA

    450     .    :    .    :    .    :    .    :    .    :
    455 CTCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58328 CTCGGGGGGCCATCAGGATTGAGAAAAATGCTGACCTCTGTTACCTCTCC

    500     .    :    .    :    .    :    .    :    .    :
    505 ACTGTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58378 ACTGTGGACTGGTCCCTGATCCTGGATGCGGTGTCCAATAACTACATTGT

    550     .    :    .    :    .    :    .    :    .    :
    555 GGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58428 GGGGAATAAGCCCCCAAAGGAATGTGGGGACCTGTGTCCAGGGACCATGG

    600     .    :    .    :    .    :    .    :    .    :
    605 AGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  58478 AGGAGAAGCCGATGTGTGAGAAGACCACCATCAACAATGAGTACAACTAC

    650     .    :    .    :    .    :    .    :    .    :
    655 CGCTGCTGGACCACAAACCGCTGCCAGAAAA         TGTGCCCAAG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  58528 CGCTGCTGGACCACAAACCGCTGCCAGAAAAGTA...CAGTGTGCCCAAG

    700     .    :    .    :    .    :    .    :    .    :
    696 CACGTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241786 CACGTGTGGGAAGCGGGCGTGCACCGAGAACAATGAGTGCTGCCACCCCG

    750     .    :    .    :    .    :    .    :    .    :
    746 AGTGCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241836 AGTGCCTGGGCAGCTGCAGCGCGCCTGACAACGACACGGCCTGTGTAGCT

    800     .    :    .    :    .    :    .    :    .    :
    796 TGCCGCCACTACTACTATGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241886 TGCCGCCACTACTACTATGCCGGTGTCTGTGTGCCTGCCTGCCCGCCCAA

    850     .    :    .    :    .    :    .    :    .    :
    846 CACCTACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACTTCTGCGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241936 CACCTACAGGTTTGAGGGCTGGCGCTGTGTGGACCGTGACTTCTGCGCCA

    900     .    :    .    :    .    :    .    :    .    :
    896 ACATCCTCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 241986 ACATCCTCAGCGCCGAGAGCAGCGACTCCGAGGGGTTTGTGATCCACGAC

    950     .    :    .    :    .    :    .    :    .    :
    946 GGCGAGTGCATGCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 242036 GGCGAGTGCATGCAGGAGTGCCCCTCGGGCTTCATCCGCAACGGCAGCCA

   1000     .    :    .    :    .    :    .    :    .    :
    996 GAG         CATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGG
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 242086 GAGGTC...CAGCATGTACTGCATCCCTTGTGAAGGTCCTTGCCCGAAGG

   1050     .    :    .    :    .    :    .    :    .    :
   1037 TCTGTGAGGAAGAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247246 TCTGTGAGGAAGAAAAGAAAACAAAGACCATTGATTCTGTTACTTCTGCT

   1100     .    :    .    :    .    :    .    :    .    :
   1087 CAGATGCTCCAAGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 247296 CAGATGCTCCAAGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACAT

   1150     .    :    .    :    .    :    .    :    .    :
   1137 CCGACGGGGGA         ATAACATTGCTTCAGAGCTGGAGAACTTCA
        |||||||||||>>>...>>>||||||||||||||||||||||||||||||
 247346 CCGACGGGGGAGTA...TAGATAACATTGCTTCAGAGCTGGAGAACTTCA

   1200     .    :    .    :    .    :    .    :    .    :
   1178 TGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 249958 TGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCAT

   1250     .    :    .    :    .    :    .    :    .    :
   1228 GCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 250008 GCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGA

   1300     .    :    .    :    .    :    .    :    .    :
   1278 GGAGCAGCTAGAAGG         GAATTACTCCTTCTACGTCCTCGACA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
 250058 GGAGCAGCTAGAAGGGTA...TAGGAATTACTCCTTCTACGTCCTCGACA

   1350     .    :    .    :    .    :    .    :    .    :
   1319 ACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259162 ACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATC

   1400     .    :    .    :    .    :    .    :    .    :
   1369 AAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259212 AAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGA

   1450     .    :    .    :    .    :    .    :    .    :
   1419 AATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 259262 AATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAG

   1500     .    :    .    :    .    :    .    :    .    :
   1469 GGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCT         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
 259312 GGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTG...CAGGT

   1550     .    :    .    :    .    :    .    :    .    :
   1510 GAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261768 GAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCAT

   1600     .    :    .    :    .    :    .    :    .    :
   1560 CATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCTCATCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 261818 CATCATAACCTGGCACCGGTACCGGCCCCCTGACTACAGGGATCTCATCA

   1650     .    :    .    :    .    :    .    :    .    :
   1610 GCTTCACCGTTTACTACAAGGAAGC         ACCCTTTAAGAATGTC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 261868 GCTTCACCGTTTACTACAAGGAAGCGTG...CAGACCCTTTAAGAATGTC

   1700     .    :    .    :    .    :    .    :    .    :
   1651 ACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263511 ACAGAGTATGATGGGCAGGATGCCTGCGGCTCCAACAGCTGGAACATGGT

   1750     .    :    .    :    .    :    .    :    .    :
   1701 GGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263561 GGACGTGGACCTCCCGCCCAACAAGGACGTGGAGCCCGGCATCTTACTAC

   1800     .    :    .    :    .    :    .    :    .    :
   1751 ATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263611 ATGGGCTGAAGCCCTGGACTCAGTACGCCGTTTACGTCAAGGCTGTGACC

   1850     .    :    .    :    .    :    .    :    .    :
   1801 CTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 263661 CTCACCATGGTGGAGAACGACCATATCCGTGGGGCCAAGAGTGAGATCTT

   1900     .    :    .    :    .    :    .    :    .    :
   1851 GTACATTCGCACCAATGCTTCAG         TTCCTTCCATTCCCTTGG
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 263711 GTACATTCGCACCAATGCTTCAGGTA...CAGTTCCTTCCATTCCCTTGG

   1950     .    :    .    :    .    :    .    :    .    :
   1892 ACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGGAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266433 ACGTTCTTTCAGCATCGAACTCCTCTTCTCAGTTAATCGTGAAGTGGAAC

   2000     .    :    .    :    .    :    .    :    .    :
   1942 CCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266483 CCTCCCTCTCTGCCCAACGGCAACCTGAGTTACTACATTGTGCGCTGGCA

   2050     .    :    .    :    .    :    .    :    .    :
   1992 GCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACTGCTCCAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 266533 GCGGCAGCCTCAGGACGGCTACCTTTACCGGCACAATTACTGCTCCAAAG

   2100     .    :    .    :    .    :    .    :    .    :
   2042          ACAAAATCCCCATCAGGAAGTATGCCGACGGCACCATCGAC
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
 266583 GTA...AAGACAAAATCCCCATCAGGAAGTATGCCGACGGCACCATCGAC

   2150     .    :    .    :    .    :    .    :    .    :
   2083 ATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267164 ATTGAGGAGGTCACAGAGAACCCCAAGACTGAGGTGTGTGGTGGGGAGAA

   2200     .    :    .    :    .    :    .    :    .    :
   2133 AGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267214 AGGGCCTTGCTGCGCCTGCCCCAAAACTGAAGCCGAGAAGCAGGCCGAGA

   2250     .    :    .    :    .    :    .    :    .    :
   2183 AGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 267264 AGGAGGAGGCTGAATACCGCAAAGTCTTTGAGAATTTCCTGCACAACTCC

   2300     .    :    .    :    .    :    .    :    .    :
   2233 ATCTTCGTGCCCAG         ACCTGAAAGGAAGCGGAGAGATGTCAT
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 267314 ATCTTCGTGCCCAGGTA...CAGACCTGAAAGGAAGCGGAGAGATGTCAT

   2350     .    :    .    :    .    :    .    :    .    :
   2274 GCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAACACCACGGCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272626 GCAAGTGGCCAACACCACCATGTCCAGCCGAAGCAGGAACACCACGGCCG

   2400     .    :    .    :    .    :    .    :    .    :
   2324 CAGACACCTACAACATCACCGACCCGGAAGAGCTGGAGACAGAGTACCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272676 CAGACACCTACAACATCACCGACCCGGAAGAGCTGGAGACAGAGTACCCT

   2450     .    :    .    :    .    :    .    :    .    :
   2374 TTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTCATTTCTAACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272726 TTCTTTGAGAGCAGAGTGGATAACAAGGAGAGAACTGTCATTTCTAACCT

   2500     .    :    .    :    .    :    .    :    .    :
   2424 TCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTGCAACCACGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272776 TCGGCCTTTCACATTGTACCGCATCGATATCCACAGCTGCAACCACGAGG

   2550     .    :    .    :    .    :    .    :    .    :
   2474 CTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGCAAGGACTATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 272826 CTGAGAAGCTGGGCTGCAGCGCCTCCAACTTCGTCTTTGCAAGGACTATG

   2600     .    :    .    :    .    :    .    :    .    :
   2524 CCCGCAG         AAGGAGCAGATGACATTCCTGGGCCAGTGACCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
 272876 CCCGCAGGTA...CAGAAGGAGCAGATGACATTCCTGGGCCAGTGACCTG

   2650     .    :    .    :    .    :    .    :    .    :
   2565 GGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGTGGCCGGAACCTGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274361 GGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGTGGCCGGAACCTGAGA

   2700     .    :    .    :    .    :    .    :    .    :
   2615 ATCCCAATGGATTGATTCTAATGTATGAAATAAAATACGGATCACAAGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 274411 ATCCCAATGGATTGATTCTAATGTATGAAATAAAATACGGATCACAAGTT

   2750     .    :    .    :    .    :    .    :    .    :
   2665 GAG         GATCAGCGAGAATGTGTGTCCAGACAGGAATACAGGAA
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 274461 GAGGTA...CAGGATCAGCGAGAATGTGTGTCCAGACAGGAATACAGGAA

   2800     .    :    .    :    .    :    .    :    .    :
   2706 GTATGGAGGGGCCAAGCTAAACCGGCTAAACCCGGGGAACTACACAGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 275014 GTATGGAGGGGCCAAGCTAAACCGGCTAAACCCGGGGAACTACACAGCCC

   2850     .    :    .    :    .    :    .    :    .    :
   2756 GGATTCAGGCCACATCTCTCTCTGGGAATGGGTCGTGGACAGATCCTGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 275064 GGATTCAGGCCACATCTCTCTCTGGGAATGGGTCGTGGACAGATCCTGTG

   2900     .    :    .    :    .    :    .    :    .    :
   2806 TTCTTCTATGTCCAGGCCAAAA         CAGGATATGAAAACTTCAT
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
 275114 TTCTTCTATGTCCAGGCCAAAAGTA...CAGCAGGATATGAAAACTTCAT

   2950     .    :    .    :    .    :    .    :    .    :
   2847 CCATCTGATCATCGCTCTGCCCGTCGCTGTCCTGTTGATCGTGGGAGGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 280028 CCATCTGATCATCGCTCTGCCCGTCGCTGTCCTGTTGATCGTGGGAGGGT

   3000     .    :    .    :    .    :    .    :    .    :
   2897 TGGTGATTATGCTGTACGTCTTCCATAGAAAGAG         AAATAAC
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
 280078 TGGTGATTATGCTGTACGTCTTCCATAGAAAGAGGTC...CAGAAATAAC

   3050     .    :    .    :    .    :    .    :    .    :
   2938 AGCAGGCTGGGGAATGGAGTGCTGTATGCCTCTGTGAACCCGGAGTACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 280693 AGCAGGCTGGGGAATGGAGTGCTGTATGCCTCTGTGAACCCGGAGTACTT

   3100     .    :    .    :    .    :    .    :    .    :
   2988 CAGCGCTGCTGATG         TGTACGTTCCTGATGAGTGGGAGGTGG
        ||||||||||||||>>>...>>>|||||||||||||||||||||||||||
 280743 CAGCGCTGCTGATGGTA...CAGTGTACGTTCCTGATGAGTGGGAGGTGG

   3150     .    :    .    :    .    :    .    :    .    :
   3029 CTCGGGAGAAGATCACCATGAGCCGGGAACTTGGGCAGGGGTCGTTTGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 285302 CTCGGGAGAAGATCACCATGAGCCGGGAACTTGGGCAGGGGTCGTTTGGG

   3200     .    :    .    :    .    :    .    :    .    :
   3079 ATGGTCTATGAAGGAGTTGCCAAGGGTGTGGTGAAAGATGAACCTGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 285352 ATGGTCTATGAAGGAGTTGCCAAGGGTGTGGTGAAAGATGAACCTGAAAC

   3250     .    :    .    :    .    :    .    :    .    :
   3129 CAGAGTGGCCATTAAAACAGTGAACGAGGCCGCAAGCATGCGTGAGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 285402 CAGAGTGGCCATTAAAACAGTGAACGAGGCCGCAAGCATGCGTGAGAGGA

   3300     .    :    .    :    .    :    .    :    .    :
   3179 TTGAGTTTCTCAACGAAGCTTCTGTGATGAAGGAGTTCAATTGTCACCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 285452 TTGAGTTTCTCAACGAAGCTTCTGTGATGAAGGAGTTCAATTGTCACCAT

   3350     .    :    .    :    .    :    .    :    .    :
   3229 GTG         GTGCGATTGCTGGGTGTGGTGTCCCAAGGCCAGCCAAC
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
 285502 GTGGTA...CAGGTGCGATTGCTGGGTGTGGTGTCCCAAGGCCAGCCAAC

   3400     .    :    .    :    .    :    .    :    .    :
   3270 ACTGGTCATCATGGAACTGATGACACGGGGCGATCTCAAAAGTTATCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 285805 ACTGGTCATCATGGAACTGATGACACGGGGCGATCTCAAAAGTTATCTCC

   3450     .    :    .    :    .    :    .    :    .    :
   3320 GGTCTCTGAGGCCAGAAATGGAG         AATAATCCAGTCCTAGCA
        |||||||||||||||||||||||>>>...>>>||||||||||||||||||
 285855 GGTCTCTGAGGCCAGAAATGGAGGTC...CAGAATAATCCAGTCCTAGCA

   3500     .    :    .    :    .    :    .    :    .    :
   3361 CCTCCAAGCCTGAGCAAGATGATTCAGATGGCCGGAGAGATTGCAGACGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 289670 CCTCCAAGCCTGAGCAAGATGATTCAGATGGCCGGAGAGATTGCAGACGG

   3550     .    :    .    :    .    :    .    :    .    :
   3411 CATGGCATACCTCAACGCCAATAAGTTCGTCCACAGAGACCTTGCTGCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 289720 CATGGCATACCTCAACGCCAATAAGTTCGTCCACAGAGACCTTGCTGCCC

   3600     .    :    .    :    .    :    .    :    .    :
   3461 GGAATTGCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
 289770 GGAATTGCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAGGTG...CA

   3650     .    :    .    :    .    :    .    :    .    :
   3503  ATTTTGGTATGACGCGAGATATCTATGAGACAGACTATTACCGGAAAGG
        >|||||||||||||||||||||||||||||||||||||||||||||||||
 293373 GATTTTGGTATGACGCGAGATATCTATGAGACAGACTATTACCGGAAAGG

   3700     .    :    .    :    .    :    .    :    .    :
   3552 AGGCAAAGGGCTGCTGCCCGTGCGCTGGATGTCTCCTGAGTCCCTCAAGG
        ||| ||||||||||||||||||||||||||||||||||||||||||||||
 293423 AGGGAAAGGGCTGCTGCCCGTGCGCTGGATGTCTCCTGAGTCCCTCAAGG

   3750     .    :    .    :    .    :    .    :    .    :
   3602 ATGGAGTCTTCACCACTTACTCGGACGTCTG         GTCCTTCGGG
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
 293473 ATGGAGTCTTCACCACTTACTCGGACGTCTGGTA...TAGGTCCTTCGGG

   3800     .    :    .    :    .    :    .    :    .    :
   3643 GTCGTCCTCTGGGAGATCGCCACACTGGCCGAGCAGCCCTACCAGGGCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 299035 GTCGTCCTCTGGGAGATCGCCACACTGGCCGAGCAGCCCTACCAGGGCTT

   3850     .    :    .    :    .    :    .    :    .    :
   3693 GTCCAACGAGCAAGTCCTTCGCTTCGTCATGGAGGGCGGCCTTCTGGACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 299085 GTCCAACGAGCAAGTCCTTCGCTTCGTCATGGAGGGCGGCCTTCTGGACA

   3900     .    :    .    :    .    :    .    :    .    :
   3743 AGCCAGACAACTGTCCTGACATGCT         GTTTGAACTGATGCGC
        |||||||||||||||||||||||||>>>...>>>||||||||||||||||
 299135 AGCCAGACAACTGTCCTGACATGCTGTA...CAGGTTTGAACTGATGCGC

   3950     .    :    .    :    .    :    .    :    .    :
   3784 ATGTGCTGGCAGTATAACCCCAAGATGAGGCCTTCCTTCCTGGAGATCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307528 ATGTGCTGGCAGTATAACCCCAAGATGAGGCCTTCCTTCCTGGAGATCAT

   4000     .    :    .    :    .    :    .    :    .    :
   3834 CAGCAGCATCAAAGAGGAGATGGAGCCTGGCTTCCGGGAGGTCTCCTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307578 CAGCAGCATCAAAGAGGAGATGGAGCCTGGCTTCCGGGAGGTCTCCTTCT

   4050     .    :    .    :    .    :    .    :    .    :
   3884 ACTACAGCGAGGAGAACAAGCTGCCCGAGCCGGAGGAGCTGGACCTGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307628 ACTACAGCGAGGAGAACAAGCTGCCCGAGCCGGAGGAGCTGGACCTGGAG

   4100     .    :    .    :    .    :    .    :    .    :
   3934 CCAGAGAACATGGAGAGCGTCCCCCTGGACCCCTCGGCCTCCTCGTCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307678 CCAGAGAACATGGAGAGCGTCCCCCTGGACCCCTCGGCCTCCTCGTCCTC

   4150     .    :    .    :    .    :    .    :    .    :
   3984 CCTGCCACTGCCCGACAGACACTCAGGACACAAGGCCGAGAACGGCCCCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307728 CCTGCCACTGCCCGACAGACACTCAGGACACAAGGCCGAGAACGGCCCCG

   4200     .    :    .    :    .    :    .    :    .    :
   4034 GCCCTGGGGTGCTGGTCCTCCGCGCCAGCTTCGACGAGAGACAGCCTTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307778 GCCCTGGGGTGCTGGTCCTCCGCGCCAGCTTCGACGAGAGACAGCCTTAC

   4250     .    :    .    :    .    :    .    :    .    :
   4084 GCCCACATGAACGGGGGCCGCAAGAACGAGCGGGCCTTGCCGCTGCCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307828 GCCCACATGAACGGGGGCCGCAAGAACGAGCGGGCCTTGCCGCTGCCCCA

   4300     .    :    .    :    .    :    .    :    .    :
   4134 GTCTTCGACCTGCTGATCCTTGGATCCTGAATCTGTGCAAACAGTAACGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307878 GTCTTCGACCTGCTGATCCTTGGATCCTGAATCTGTGCAAACAGTAACGT

   4350     .    :    .    :    .    :    .    :    .    :
   4184 GTGCGCACGCGCAGCGGGGTGGGGGGGGAGAGAGAGTTTTAACAATCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 307928 GTGCGCACGCGCAGCGGGGTGGGGGGGGAGAGAGAGTTTTAACAATCCAT

   4400     .    :    .    :    .    :    .    :    .    :
   4234 TCACAAGCCTCCTGTACCTCAGTGGATCTTCAGTTCTGCCCTTGCTGCCC
        |||||||||||||||||||||||||||||||||  |||||||||||||||
 307978 TCACAAGCCTCCTGTACCTCAGTGGATCTTCAGAACTGCCCTTGCTGCCC

   4450     .    :    .    :    .    :    .    :    .    :
   4284 GCGGGAGACAGCTTCTCTGCAGTAAAACACATTTGGGATGTTCCTTTTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308028 GCGGGAGACAGCTTCTCTGCAGTAAAACACATTTGGGATGTTCCTTTTTT

   4500     .    :    .    :    .    :    .    :    .    :
   4334 CAATATGCAAGCAGCTTTTTATTCCCTGCCCAAACCCTTAACTGACATGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308078 CAATATGCAAGCAGCTTTTTATTCCCTGCCCAAACCCTTAACTGACATGG

   4550     .    :    .    :    .    :    .    :    .    :
   4384 GCCTTTAAGAACCTTAATGACAACACTTAATAGCAACAGAGCACTTGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308128 GCCTTTAAGAACCTTAATGACAACACTTAATAGCAACAGAGCACTTGAGA

   4600     .    :    .    :    .    :    .    :    .    :
   4434 ACCAGTCTCCTCACTCTGTCCCTGTCCTTCCCTGTTCTCCCTTTCTCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308178 ACCAGTCTCCTCACTCTGTCCCTGTCCTTCCCTGTTCTCCCTTTCTCTCT

   4650     .    :    .    :    .    :    .    :    .    :
   4484 CCTCTCTGCTTCATAACGGAAAAATAATTGCCACAAGTCCAGCTGGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308228 CCTCTCTGCTTCATAACGGAAAAATAATTGCCACAAGTCCAGCTGGGAAG

   4700     .    :    .    :    .    :    .    :    .    :
   4534 CCCTTTTTATCAGTTTGAGGAAGTGGCTGTCCCTGTGGCCCCATCCAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308278 CCCTTTTTATCAGTTTGAGGAAGTGGCTGTCCCTGTGGCCCCATCCAACC

   4750     .    :    .    :    .    :    .    :    .    :
   4584 ACTGTACACACCCGCCTGACACCGTGGGTCATTACAAAAAAACACGTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308328 ACTGTACACACCCGCCTGACACCGTGGGTCATTACAAAAAAACACGTGGA

   4800     .    :    .    :    .    :    .    :    .    :
   4634 GATGGAAATTTTTACCTTTATCTTTCACCTTTCTAGGGACATGAAATTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308378 GATGGAAATTTTTACCTTTATCTTTCACCTTTCTAGGGACATGAAATTTA

   4850     .    :    .    :    .    :    .    :    .    :
   4684 CAAAGGGCCATCGTTCATCCAAGGCTGTTACCATTTTAACGCTGCCTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308428 CAAAGGGCCATCGTTCATCCAAGGCTGTTACCATTTTAACGCTGCCTAAT

   4900     .    :    .    :    .    :    .    :    .    :
   4734 TTTGCCAAAATCCTGAACTTTCTCCCTCATCGGCCCGGCGCTGATTCCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308478 TTTGCCAAAATCCTGAACTTTCTCCCTCATCGGCCCGGCGCTGATTCCTC

   4950     .    :    .    :    .    :    .    :    .    :
   4784 GTGTCCGGAGGCATGGGTGAGCATGGCAGCTGGTTGCTCCATTTGAGAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308528 GTGTCCGGAGGCATGGGTGAGCATGGCAGCTGGTTGCTCCATTTGAGAGA

   5000     .    :    .    :    .    :    .    :    .    :
   4834 CACGCTGGCGACACACTCCGTCCATCCGACTGCCCCTGCTGTGCTGCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308578 CACGCTGGCGACACACTCCGTCCATCCGACTGCCCCTGCTGTGCTGCTCA

   5050     .    :    .    :    .    :    .    :    .    :
   4884 AGGCCACAGGCACACAGGTCTCATTGCTTCTGACTAGATTATTATTTGGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308628 AGGCCACAGGCACACAGGTCTCATTGCTTCTGACTAGATTATTATTTGGG

   5100     .    :    .    :    .    :    .    :    .    :
   4934 GGAACTGGACACAATAGGTCTTTCTCTCAGTGAAGGTGGGGAGAAGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
 308678 GGAACTGGACACAATAGGTCTTTCTCTCAGTGAAGGTGGGGAGAAGCTGA

   5150     .
   4984 ACCGGC
        ||||||
 308728 ACCGGC

END