Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_001250.3
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_001250.3, 1177 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|23312369|ref|NM_001250.3| Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), transcript variant 1, mRNA
>ENSG00000101017

1-128  (1-128)   100% ->
129-207  (3554-3632)   100% ->
208-333  (3967-4092)   100% ->
334-480  (4344-4490)   100% ->
481-574  (4860-4953)   100% ->
575-636  (8374-8435)   100% ->
637-723  (9872-9958)   100% ->
724-752  (10064-10092)   100% ->
753-1162  (10616-11025)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT

     50     .    :    .    :    .    :    .    :    .    :
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG

    100     .    :    .    :    .    :    .    :    .    :
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAAC

    150     .    :    .    :    .    :    .    :    .    :
    142 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3567 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT

    200     .    :    .    :    .    :    .    :    .    :
    192 TCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCAC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
   3617 TCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCAC

    250     .    :    .    :    .    :    .    :    .    :
    233 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3992 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG

    300     .    :    .    :    .    :    .    :    .    :
    283 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4042 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC

    350     .    :    .    :    .    :    .    :    .    :
    333 A         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   4092 AGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC

    400     .    :    .    :    .    :    .    :    .    :
    374 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4384 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT

    450     .    :    .    :    .    :    .    :    .    :
    424 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4434 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG

    500     .    :    .    :    .    :    .    :    .    :
    474 CAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4484 CAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTG

    550     .    :    .    :    .    :    .    :    .    :
    515 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4894 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC

    600     .    :    .    :    .    :    .    :    .    :
    565 CTTGGACAAG         CTGTGAGACCAAAGACCTGGTTGTGCAACAG
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   4944 CTTGGACAAGGTA...TAGCTGTGAGACCAAAGACCTGGTTGTGCAACAG

    650     .    :    .    :    .    :    .    :    .    :
    606 GCAGGCACAAACAAGACTGATGTTGTCTGTG         GTCCCCAGGA
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
   8405 GCAGGCACAAACAAGACTGATGTTGTCTGTGGTG...CAGGTCCCCAGGA

    700     .    :    .    :    .    :    .    :    .    :
    647 TCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9882 TCGGCTGAGAGCCCTGGTGGTGATCCCCATCATCTTCGGGATCCTGTTTG

    750     .    :    .    :    .    :    .    :    .    :
    697 CCATCCTCTTGGTGCTGGTCTTTATCA         AAAAGGTGGCCAAG
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
   9932 CCATCCTCTTGGTGCTGGTCTTTATCAGTG...TAGAAAAGGTGGCCAAG

    800     .    :    .    :    .    :    .    :    .    :
    738 AAGCCAACCAATAAG         GCCCCCCACCCCAAGCAGGAACCCCA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
  10078 AAGCCAACCAATAAGGTA...CAGGCCCCCCACCCCAAGCAGGAACCCCA

    850     .    :    .    :    .    :    .    :    .    :
    779 GGAGATCAATTTTCCCGACGATCTTCCTGGCTCCAACACTGCTGCTCCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10642 GGAGATCAATTTTCCCGACGATCTTCCTGGCTCCAACACTGCTGCTCCAG

    900     .    :    .    :    .    :    .    :    .    :
    829 TGCAGGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10692 TGCAGGAGACTTTACATGGATGCCAACCGGTCACCCAGGAGGATGGCAAA

    950     .    :    .    :    .    :    .    :    .    :
    879 GAGAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10742 GAGAGTCGCATCTCAGTGCAGGAGAGACAGTGAGGCTGCACCCACCCAGG

   1000     .    :    .    :    .    :    .    :    .    :
    929 AGTGTGGCCACGTGGGCAAACAGGCAGTTGGCCAGAGAGCCTGGTGCTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10792 AGTGTGGCCACGTGGGCAAACAGGCAGTTGGCCAGAGAGCCTGGTGCTGC

   1050     .    :    .    :    .    :    .    :    .    :
    979 TGCTGCTGTGGCGTGAGGGTGAGGGGCTGGCACTGACTGGGCATAGCTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10842 TGCTGCTGTGGCGTGAGGGTGAGGGGCTGGCACTGACTGGGCATAGCTCC

   1100     .    :    .    :    .    :    .    :    .    :
   1029 CCGCTTCTGCCTGCACCCCTGCAGTTTGAGACAGGAGACCTGGCACTGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10892 CCGCTTCTGCCTGCACCCCTGCAGTTTGAGACAGGAGACCTGGCACTGGA

   1150     .    :    .    :    .    :    .    :    .    :
   1079 TGCAGAAACAGTTCACCTTGAAGAACCTCTCACTTCACCCTGGAGCCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10942 TGCAGAAACAGTTCACCTTGAAGAACCTCTCACTTCACCCTGGAGCCCAT

   1200     .    :    .    :    .    :
   1129 CCAGTCTCCCAACTTGTATTAAAGACAGAGGCAG
        ||||||||||||||||||||||||||||||||||
  10992 CCAGTCTCCCAACTTGTATTAAAGACAGAGGCAG

END