Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_007295.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_007295.1, 7365 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6552300|ref|NM_007295.1| Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1b, mRNA
>ENSG00000012048

(complement)

1-378  (278-655)   100% ->
379-477  (1277-1375)   100% ->
478-531  (9613-9666)   100% ->
532-609  (18859-18936)   100% ->
610-698  (20436-20524)   100% ->
699-838  (21131-21270)   100% ->
839-944  (25512-25617)   100% ->
945-990  (28103-28148)   100% ->
991-1067  (29470-29546)   100% ->
1068-4493  (30532-33957)   100% ->
4494-4582  (34360-34448)   100% ->
4583-4754  (42817-42988)   100% ->
4755-4881  (48778-48904)   100% ->
4882-5072  (50871-51061)   100% ->
5073-5383  (54154-54464)   100% ->
5384-5471  (57697-57784)   100% ->
5472-5549  (61441-61518)   100% ->
5550-5590  (62019-62059)   100% ->
5591-5674  (68257-68340)   100% ->
5675-5729  (74275-74329)   100% ->
5730-5803  (76198-76271)   100% ->
5804-5864  (77689-77749)   100% ->
5865-7365  (79590-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 GGCAGTTTGTAGGTCGCGAGGGAAGCGCTGAGGATCAGGAAGGGGGCACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    278 GGCAGTTTGTAGGTCGCGAGGGAAGCGCTGAGGATCAGGAAGGGGGCACT

     50     .    :    .    :    .    :    .    :    .    :
     51 GAGTGTCCGTGGGGGAATCCTCGTGATAGGAACTGGAATATGCCTTGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    328 GAGTGTCCGTGGGGGAATCCTCGTGATAGGAACTGGAATATGCCTTGAGG

    100     .    :    .    :    .    :    .    :    .    :
    101 GGGACACTATGTCTTTAAAAACGTCGGCTGGTCATGAGGTCAGGAGTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    378 GGGACACTATGTCTTTAAAAACGTCGGCTGGTCATGAGGTCAGGAGTTCC

    150     .    :    .    :    .    :    .    :    .    :
    151 AGACCAGCCTGACCAACGTGGTGAAACTCCGTCTCTACTAAAAATACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    428 AGACCAGCCTGACCAACGTGGTGAAACTCCGTCTCTACTAAAAATACAAA

    200     .    :    .    :    .    :    .    :    .    :
    201 AATTAGCCGGGCGTGGTGCCGCTCCAGCTACTCAGGAGGCTGAGGCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    478 AATTAGCCGGGCGTGGTGCCGCTCCAGCTACTCAGGAGGCTGAGGCAGGA

    250     .    :    .    :    .    :    .    :    .    :
    251 GAATCGCTAGAACCCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    528 GAATCGCTAGAACCCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCC

    300     .    :    .    :    .    :    .    :    .    :
    301 ATTGCACTCCAGCCTGGGCGACAGAGCGAGACTGTCTCAAAACAAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
    578 ATTGCACTCCAGCCTGGGCGACAGAGCGAGACTGTCTCAAAACAAAACAA

    350     .    :    .    :    .    :    .    :    .    :
    351 AACAAAACAAAACAAAAAACACCGGCTG         TTCATTGGAACAG
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    628 AACAAAACAAAACAAAAAACACCGGCTGGTA...AAGTTCATTGGAACAG

    400     .    :    .    :    .    :    .    :    .    :
    392 AAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1290 AAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCAT

    450     .    :    .    :    .    :    .    :    .    :
    442 TAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTG         TCTGG
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
   1340 TAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGGTA...TAGTCTGG

    500     .    :    .    :    .    :    .    :    .    :
    483 AGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA 
        |||||||||||||||||||||||||||||||||||||||||||||||||>
   9618 AGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAG

    550     .    :    .    :    .    :    .    :    .    :
    532         ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTC
        >>...>>>||||||||||||||||||||||||||||||||||||||||||
   9668 TA...TAGATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTC

    600     .    :    .    :    .    :    .    :    .    :
    574 ACAGTGTCCTTTATGTAAGAATGATATAACCAAAAG         GAGCC
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  18901 ACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCC

    650     .    :    .    :    .    :    .    :    .    :
    615 TACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20441 TACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATC

    700     .    :    .    :    .    :    .    :    .    :
    665 ATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAA
        ||||||||||||||||||||||||||||||||||>>>...>>>|||||||
  20491 ATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAA

    750     .    :    .    :    .    :    .    :    .    :
    706 CAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21138 CAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAG

    800     .    :    .    :    .    :    .    :    .    :
    756 ATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21188 ATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGA

    850     .    :    .    :    .    :    .    :    .    :
    806 CTTCTACAGAGTGAACCCGAAAATCCTTCCTTG         CAGGAAAC
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  21238 CTTCTACAGAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAAC

    900     .    :    .    :    .    :    .    :    .    :
    847 CAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25520 CAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGA

    950     .    :    .    :    .    :    .    :    .    :
    897 CAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
  25570 CAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGT

   1000     .    :    .    :    .    :    .    :    .    :
    945        GATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTG
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
  25620 A...TAGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTG

   1050     .    :    .    :    .    :    .    :    .    :
    988 CAG         TGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAG
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  28146 CAGGTG...TAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAG

   1100     .    :    .    :    .    :    .    :    .    :
   1029 GAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGG         CT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
  29508 GAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGGTA...CAGCT

   1150     .    :    .    :    .    :    .    :    .    :
   1070 GCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30534 GCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACC

   1200     .    :    .    :    .    :    .    :    .    :
   1120 CAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30584 CAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATC

   1250     .    :    .    :    .    :    .    :    .    :
   1170 CAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30634 CAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGT

   1300     .    :    .    :    .    :    .    :    .    :
   1220 GGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30684 GGCACAAATACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATT

   1350     .    :    .    :    .    :    .    :    .    :
   1270 ACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30734 ACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAA

   1400     .    :    .    :    .    :    .    :    .    :
   1320 GCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30784 GCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGT

   1450     .    :    .    :    .    :    .    :    .    :
   1370 AAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30834 AAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGA

   1500     .    :    .    :    .    :    .    :    .    :
   1420 TCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30884 TCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGAAAC

   1550     .    :    .    :    .    :    .    :    .    :
   1470 TGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30934 TGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACA

   1600     .    :    .    :    .    :    .    :    .    :
   1520 CTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30984 CTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGA

   1650     .    :    .    :    .    :    .    :    .    :
   1570 ACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31034 ACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCA

   1700     .    :    .    :    .    :    .    :    .    :
   1620 AAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31084 AAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCTGGT

   1750     .    :    .    :    .    :    .    :    .    :
   1670 TCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31134 TCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAAT

   1800     .    :    .    :    .    :    .    :    .    :
   1720 ATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31184 ATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAG

   1850     .    :    .    :    .    :    .    :    .    :
   1770 ACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31234 ACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTA

   1900     .    :    .    :    .    :    .    :    .    :
   1820 AGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCCACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31284 AGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCCACA

   1950     .    :    .    :    .    :    .    :    .    :
   1870 GATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31334 GATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGAC

   2000     .    :    .    :    .    :    .    :    .    :
   1920 CTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31384 CTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCA

   2050     .    :    .    :    .    :    .    :    .    :
   1970 GTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31434 GTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCA

   2100     .    :    .    :    .    :    .    :    .    :
   2020 GAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31484 GAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAA

   2150     .    :    .    :    .    :    .    :    .    :
   2070 AAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31534 AAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTC

   2200     .    :    .    :    .    :    .    :    .    :
   2120 GAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31584 GAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTAT

   2250     .    :    .    :    .    :    .    :    .    :
   2170 AAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31634 AAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAAGCACCTAAAA

   2300     .    :    .    :    .    :    .    :    .    :
   2220 AGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTTGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31684 AGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTTGAA

   2350     .    :    .    :    .    :    .    :    .    :
   2270 CTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31734 CTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAAT

   2400     .    :    .    :    .    :    .    :    .    :
   2320 TGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31784 TGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAA

   2450     .    :    .    :    .    :    .    :    .    :
   2370 TGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31834 TGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCT

   2500     .    :    .    :    .    :    .    :    .    :
   2420 GCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31884 GCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAG

   2550     .    :    .    :    .    :    .    :    .    :
   2470 ACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31934 ACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTT

   2600     .    :    .    :    .    :    .    :    .    :
   2520 CTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  31984 CTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCT

   2650     .    :    .    :    .    :    .    :    .    :
   2570 AGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32034 AGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTC

   2700     .    :    .    :    .    :    .    :    .    :
   2620 TAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32084 TAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTT

   2750     .    :    .    :    .    :    .    :    .    :
   2670 TGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32134 TGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGT

   2800     .    :    .    :    .    :    .    :    .    :
   2720 ACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32184 ACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCT

   2850     .    :    .    :    .    :    .    :    .    :
   2770 AGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32234 AGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCAT

   2900     .    :    .    :    .    :    .    :    .    :
   2820 TTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32284 TTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAAT

   2950     .    :    .    :    .    :    .    :    .    :
   2870 GACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32334 GACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCG

   3000     .    :    .    :    .    :    .    :    .    :
   2920 GGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32384 GGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGC

   3050     .    :    .    :    .    :    .    :    .    :
   2970 AGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32434 AGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAAT

   3100     .    :    .    :    .    :    .    :    .    :
   3020 CCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32484 CCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTC

   3150     .    :    .    :    .    :    .    :    .    :
   3070 CTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32534 CTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAG

   3200     .    :    .    :    .    :    .    :    .    :
   3120 AAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32584 AAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAAT

   3250     .    :    .    :    .    :    .    :    .    :
   3170 ATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32634 ATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAA

   3300     .    :    .    :    .    :    .    :    .    :
   3220 TGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32684 TGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGT

   3350     .    :    .    :    .    :    .    :    .    :
   3270 TCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32734 TCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTA

   3400     .    :    .    :    .    :    .    :    .    :
   3320 CAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32784 CAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAA

   3450     .    :    .    :    .    :    .    :    .    :
   3370 AACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32834 AACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATTCAA

   3500     .    :    .    :    .    :    .    :    .    :
   3420 TGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32884 TGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGC

   3550     .    :    .    :    .    :    .    :    .    :
   3470 ACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32934 ACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTC

   3600     .    :    .    :    .    :    .    :    .    :
   3520 AAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  32984 AAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTA

   3650     .    :    .    :    .    :    .    :    .    :
   3570 TTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGTAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33034 TTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGTAGA

   3700     .    :    .    :    .    :    .    :    .    :
   3620 AACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33084 AACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACC

   3750     .    :    .    :    .    :    .    :    .    :
   3670 TGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33134 TGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAA

   3800     .    :    .    :    .    :    .    :    .    :
   3720 TAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33184 TAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTC

   3850     .    :    .    :    .    :    .    :    .    :
   3770 TCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33234 TCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCA

   3900     .    :    .    :    .    :    .    :    .    :
   3820 TGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33284 TGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTG

   3950     .    :    .    :    .    :    .    :    .    :
   3870 AAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33334 AAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCT

   4000     .    :    .    :    .    :    .    :    .    :
   3920 GCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33384 GCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAG

   4050     .    :    .    :    .    :    .    :    .    :
   3970 CCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33434 CCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGA

   4100     .    :    .    :    .    :    .    :    .    :
   4020 AATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33484 AATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCC

   4150     .    :    .    :    .    :    .    :    .    :
   4070 TGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33534 TGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTC

   4200     .    :    .    :    .    :    .    :    .    :
   4120 TACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33584 TACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGG

   4250     .    :    .    :    .    :    .    :    .    :
   4170 AGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33634 AGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTA

   4300     .    :    .    :    .    :    .    :    .    :
   4220 ATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33684 ATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATG

   4350     .    :    .    :    .    :    .    :    .    :
   4270 TTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33734 TTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTG

   4400     .    :    .    :    .    :    .    :    .    :
   4320 CAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33784 CAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATG

   4450     .    :    .    :    .    :    .    :    .    :
   4370 AGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33834 AGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGT

   4500     .    :    .    :    .    :    .    :    .    :
   4420 TTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  33884 TTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAG

   4550     .    :    .    :    .    :    .    :    .    :
   4470 AGCAAAGCATGGATTCAAACTTAG         GTGAAGCAGCATCTGGG
        ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
  33934 AGCAAAGCATGGATTCAAACTTAGGTA...AAGGTGAAGCAGCATCTGGG

   4600     .    :    .    :    .    :    .    :    .    :
   4511 TGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34377 TGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCA

   4650     .    :    .    :    .    :    .    :    .    :
   4561 GAGTGACATTTTAACCACTCAG         CAGAGGGATACCATGCAAC
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
  34427 GAGTGACATTTTAACCACTCAGGTA...AAGCAGAGGGATACCATGCAAC

   4700     .    :    .    :    .    :    .    :    .    :
   4602 ATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42836 ATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTA

   4750     .    :    .    :    .    :    .    :    .    :
   4652 GAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42886 GAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGA

   4800     .    :    .    :    .    :    .    :    .    :
   4702 CTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42936 CTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAA

   4850     .    :    .    :    .    :    .    :    .    :
   4752 AAG         CAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATA
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  42986 AAGGTG...AAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATA

   4900     .    :    .    :    .    :    .    :    .    :
   4793 AGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48816 AGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGA

   4950     .    :    .    :    .    :    .    :    .    :
   4843 TAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAG         GT
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
  48866 TAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTA...TAGGT

   5000     .    :    .    :    .    :    .    :    .    :
   4884 CATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50873 CATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGT

   5050     .    :    .    :    .    :    .    :    .    :
   4934 TGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50923 TGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCTCAT

   5100     .    :    .    :    .    :    .    :    .    :
   4984 TAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50973 TAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACG

   5150     .    :    .    :    .    :    .    :    .    :
   5034 ATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG         AG
        |||||||||||||||||||||||||||||||||||||||>>>...>>>||
  51023 ATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGGTA...CAGAG

   5200     .    :    .    :    .    :    .    :    .    :
   5075 GGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54156 GGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGA

   5250     .    :    .    :    .    :    .    :    .    :
   5125 ATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54206 ATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACA

   5300     .    :    .    :    .    :    .    :    .    :
   5175 TACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54256 TACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAA

   5350     .    :    .    :    .    :    .    :    .    :
   5225 TCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54306 TCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAA

   5400     .    :    .    :    .    :    .    :    .    :
   5275 TGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54356 TGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAA

   5450     .    :    .    :    .    :    .    :    .    :
   5325 CAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54406 CAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCA

   5500     .    :    .    :    .    :    .    :    .    :
   5375 GAAGAATTT         ATGCTCGTGTACAAGTTTGCCAGAAAACACCA
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
  54456 GAAGAATTTGTG...CAGATGCTCGTGTACAAGTTTGCCAGAAAACACCA

   5550     .    :    .    :    .    :    .    :    .    :
   5416 CATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57729 CATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGA

   5600     .    :    .    :    .    :    .    :    .    :
   5466 AAACAG         ATGCTGAGTTTGTGTGTGAACGGACACTGAAATAT
        ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
  57779 AAACAGGTA...CAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATAT

   5650     .    :    .    :    .    :    .    :    .    :
   5507 TTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
  61476 TTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGTA...T

   5700     .    :    .    :    .    :    .    :    .    :
   5550   GGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAG       
        >>|||||||||||||||||||||||||||||||||||||||||>>>...>
  62017 AGGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGGTA...C

   5750     .    :    .    :    .    :    .    :    .    :
   5591   CATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAA
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  68255 AGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAA

   5800     .    :    .    :    .    :    .    :    .    :
   5639 GGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG         ATCTT
        ||||||||||||||||||||||||||||||||||||>>>...>>>|||||
  68305 GGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGGTA...CAGATCTT

   5850     .    :    .    :    .    :    .    :    .    :
   5680 CAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  74280 CAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAG

   5900     .    :    .    :    .    :    .    :    .    :
   5730          ATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTG
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  74330 GTA...TAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTG

   5950     .    :    .    :    .    :    .    :    .    :
   5771 GTGAAGGAGCTTTCATCATTCACCCTTGGCACA         GGTGTCCA
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  76239 GTGAAGGAGCTTTCATCATTCACCCTTGGCACAGTA...CAGGGTGTCCA

   6000     .    :    .    :    .    :    .    :    .    :
   5812 CCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  77697 CCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCC

   6050     .    :    .    :    .    :    .    :    .    :
   5862 ATG         CAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGA
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  77747 ATGGTA...CAGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGA

   6100     .    :    .    :    .    :    .    :    .    :
   5903 GAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79628 GAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACAC

   6150     .    :    .    :    .    :    .    :    .    :
   5953 CTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAGCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79678 CTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAGCCA

   6200     .    :    .    :    .    :    .    :    .    :
   6003 CAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAAAGTGGCCTTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79728 CAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAAAGTGGCCTTTC

   6250     .    :    .    :    .    :    .    :    .    :
   6053 CAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGGCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79778 CAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGGCTA

   6300     .    :    .    :    .    :    .    :    .    :
   6103 CTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCAAGG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79828 CTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCAAGG

   6350     .    :    .    :    .    :    .    :    .    :
   6153 GTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCATGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79878 GTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCATGAG

   6400     .    :    .    :    .    :    .    :    .    :
   6203 CACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79928 CACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTTAAA

   6450     .    :    .    :    .    :    .    :    .    :
   6253 CGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATTCTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79978 CGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATTCTT

   6500     .    :    .    :    .    :    .    :    .    :
   6303 TCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80028 TCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGC

   6550     .    :    .    :    .    :    .    :    .    :
   6353 CTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80078 CTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGT

   6600     .    :    .    :    .    :    .    :    .    :
   6403 TCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80128 TCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGAT

   6650     .    :    .    :    .    :    .    :    .    :
   6453 CGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80178 CGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTT

   6700     .    :    .    :    .    :    .    :    .    :
   6503 GGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80228 GGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAA

   6750     .    :    .    :    .    :    .    :    .    :
   6553 GGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80278 GGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTT

   6800     .    :    .    :    .    :    .    :    .    :
   6603 TGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80328 TGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGC

   6850     .    :    .    :    .    :    .    :    .    :
   6653 CTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80378 CTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCC

   6900     .    :    .    :    .    :    .    :    .    :
   6703 GGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80428 GGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCA

   6950     .    :    .    :    .    :    .    :    .    :
   6753 GGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80478 GGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCAT

   7000     .    :    .    :    .    :    .    :    .    :
   6803 ACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80528 ACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAA

   7050     .    :    .    :    .    :    .    :    .    :
   6853 AAAAAAAAA GGAAAATGAAACTAGGAAAGGTTTCTTAAAGTCTGAGATA
        |||||||||-||||||||||||||| | || ||||| |||||||||||||
  80578 AAAAAAAAAAGGAAAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATA

   7100     .    :    .    :    .    :    .    :    .    :
   6902 TATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80628 TATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCA

   7150     .    :    .    :    .    :    .    :    .    :
   6952 AGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80678 AGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAA

   7200     .    :    .    :    .    :    .    :    .    :
   7002 AATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80728 AATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATA

   7250     .    :    .    :    .    :    .    :    .    :
   7052 AGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80778 AGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAG

   7300     .    :    .    :    .    :    .    :    .    :
   7102 GAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80828 GAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGT

   7350     .    :    .    :    .    :    .    :    .    :
   7152 TGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80878 TGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAA

   7400     .    :    .    :    .    :    .    :    .    :
   7202 AAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80928 AAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAG

   7450     .    :    .    :    .    :    .    :    .    :
   7252 GACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80978 GACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGA

   7500     .    :    .    :    .    :    .    :    .    :
   7302 TTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAATAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81028 TTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAATAAA

   7550     .    :
   7352 CTTGGTAGCAAACA
        ||||||||||||||
  81078 CTTGGTAGCAAACA

END