Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_007303.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_007303.1, 3682 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6552316|ref|NM_007303.1| Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta11, mRNA
>ENSG00000012048

(complement)

1-122  (1-121)   95% ->
123-221  (1277-1375)   100% ->
222-275  (9613-9666)   100% ->
276-353  (18859-18936)   100% ->
354-442  (20436-20524)   100% ->
443-582  (21131-21270)   100% ->
583-688  (25512-25617)   100% ->
689-734  (28103-28148)   100% ->
735-811  (29470-29546)   100% ->
812-900  (34360-34448)   100% ->
901-1072  (42817-42988)   100% ->
1073-1199  (48778-48904)   100% ->
1200-1390  (50871-51061)   100% ->
1391-1701  (54154-54464)   100% ->
1702-1789  (57697-57784)   100% ->
1790-1867  (61441-61518)   100% ->
1868-1908  (62019-62059)   100% ->
1909-1992  (68257-68340)   100% ->
1993-2047  (74275-74329)   100% ->
2048-2121  (76198-76271)   100% ->
2122-2182  (77689-77749)   100% ->
2183-3682  (79590-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCA
        ||||||||||||||||||||||||||||||||||||||||||||   | |
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACGGGGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT
        |-||||||||||||||||||||||||||||||||||||||||||||||||
     51 C AGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 TCACCCTCTGCTCTGGGTAAAG         TTCATTGGAACAGAAAGAA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
    100 TCACCCTCTGCTCTGGGTAAAGGTA...AAGTTCATTGGAACAGAAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1296 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC

    200     .    :    .    :    .    :    .    :    .    :
    192 TATGCAGAAAATCTTAGAGTGTCCCATCTG         TCTGGAGTTGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
   1346 TATGCAGAAAATCTTAGAGTGTCCCATCTGGTA...TAGTCTGGAGTTGA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
   9624 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGTA...T

    300     .    :    .    :    .    :    .    :    .    :
    276   ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  18857 AGATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG

    350     .    :    .    :    .    :    .    :    .    :
    324 TCCTTTATGTAAGAATGATATAACCAAAAG         GAGCCTACAAG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  18907 TCCTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCCTACAAG

    400     .    :    .    :    .    :    .    :    .    :
    365 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20447 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT

    450     .    :    .    :    .    :    .    :    .    :
    415 GCTTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAACAGCTA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  20497 GCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAACAGCTA

    500     .    :    .    :    .    :    .    :    .    :
    456 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21144 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG

    550     .    :    .    :    .    :    .    :    .    :
    506 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21194 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA

    600     .    :    .    :    .    :    .    :    .    :
    556 CAGAGTGAACCCGAAAATCCTTCCTTG         CAGGAAACCAGTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  21244 CAGAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAACCAGTCT

    650     .    :    .    :    .    :    .    :    .    :
    597 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25526 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC

    700     .    :    .    :    .    :    .    :    .    :
    647 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  25576 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGTA...TA

    750     .    :    .    :    .    :    .    :    .    :
    689  GATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAG   
        >||||||||||||||||||||||||||||||||||||||||||||||>>>
  28102 GGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGGTG

    800     .    :    .    :    .    :    .    :    .    :
    735       TGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCA
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  28152 ...TAGTGTGGGAGATCAAGAATTGTTACAAATCACCCCTCAAGGAACCA

    850     .    :    .    :    .    :    .    :    .    :
    779 GGGATGAAATCAGTTTGGATTCTGCAAAAAAGG         GTGAAGCA
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  29514 GGGATGAAATCAGTTTGGATTCTGCAAAAAAGGGTA...AAGGTGAAGCA

    900     .    :    .    :    .    :    .    :    .    :
    820 GCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34368 GCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCT

    950     .    :    .    :    .    :    .    :    .    :
    870 ATCCTCTCAGAGTGACATTTTAACCACTCAG         CAGAGGGATA
        |||||||||||||||||||||||||||||||>>>...>>>||||||||||
  34418 ATCCTCTCAGAGTGACATTTTAACCACTCAGGTA...AAGCAGAGGGATA

   1000     .    :    .    :    .    :    .    :    .    :
    911 CCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42827 CCATGCAACATAACCTGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAA

   1050     .    :    .    :    .    :    .    :    .    :
    961 GCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42877 GCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCAT

   1100     .    :    .    :    .    :    .    :    .    :
   1011 CATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42927 CATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCA

   1150     .    :    .    :    .    :    .    :    .    :
   1061 CATCAGAAAAAG         CAGTATTAACTTCACAGAAAAGTAGTGAA
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  42977 CATCAGAAAAAGGTG...AAGCAGTATTAACTTCACAGAAAAGTAGTGAA

   1200     .    :    .    :    .    :    .    :    .    :
   1102 TACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48807 TACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGT

   1250     .    :    .    :    .    :    .    :    .    :
   1152 GTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
  48857 GTCTGCAGATAGTTCTACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGT

   1300     .    :    .    :    .    :    .    :    .    :
   1200        GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTAC
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
  48907 A...TAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTAC

   1350     .    :    .    :    .    :    .    :    .    :
   1243 ATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50914 ATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGA

   1400     .    :    .    :    .    :    .    :    .    :
   1293 GGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50964 GGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTG

   1450     .    :    .    :    .    :    .    :    .    :
   1343 GGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG  
        ||||||||||||||||||||||||||||||||||||||||||||||||>>
  51014 GGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGGT

   1500     .    :    .    :    .    :    .    :    .    :
   1391        AGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGA
        >...>>>|||||||||||||||||||||||||||||||||||||||||||
  51064 A...CAGAGGGAACCCCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGA

   1550     .    :    .    :    .    :    .    :    .    :
   1434 TGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54197 TGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTG

   1600     .    :    .    :    .    :    .    :    .    :
   1484 TTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54247 TTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAA

   1650     .    :    .    :    .    :    .    :    .    :
   1534 GTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54297 GTTGCAGAATCTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGC

   1700     .    :    .    :    .    :    .    :    .    :
   1584 TGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54347 TGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGA

   1750     .    :    .    :    .    :    .    :    .    :
   1634 CAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54397 CAGCTTCAACAGAAAGGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGC

   1800     .    :    .    :    .    :    .    :    .    :
   1684 CTGACCCCAGAAGAATTT         ATGCTCGTGTACAAGTTTGCCAG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
  54447 CTGACCCCAGAAGAATTTGTG...CAGATGCTCGTGTACAAGTTTGCCAG

   1850     .    :    .    :    .    :    .    :    .    :
   1725 AAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57720 AAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATG

   1900     .    :    .    :    .    :    .    :    .    :
   1775 TTGTTATGAAAACAG         ATGCTGAGTTTGTGTGTGAACGGACA
        |||||||||||||||>>>...>>>||||||||||||||||||||||||||
  57770 TTGTTATGAAAACAGGTA...CAGATGCTGAGTTTGTGTGTGAACGGACA

   1950     .    :    .    :    .    :    .    :    .    :
   1816 CTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  61467 CTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTT

   2000     .    :    .    :    .    :    .    :    .    :
   1866 CT         GGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATG
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
  61517 CTGTA...TAGGGGTGACCCAGTCTATTAAAGAAAGAAAAATGCTGAATG

   2050     .    :    .    :    .    :    .    :    .    :
   1907 AG         CATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA
        ||>>>...>>>|||||||||||||||||||||||||||||||||||||||
  62058 AGGTA...CAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGA

   2100     .    :    .    :    .    :    .    :    .    :
   1948 AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAG     
        |||||||||||||||||||||||||||||||||||||||||||||>>>..
  68296 AACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGGTA..

   2150     .    :    .    :    .    :    .    :    .    :
   1993     ATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACA
        .>>>||||||||||||||||||||||||||||||||||||||||||||||
  68346 .CAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACA

   2200     .    :    .    :    .    :    .    :    .    :
   2039 TGCCCACAG         ATCAACTGGAATGGATGGTACAGCTGTGTGGT
        |||||||||>>>...>>>||||||||||||||||||||||||||||||||
  74321 TGCCCACAGGTA...TAGATCAACTGGAATGGATGGTACAGCTGTGTGGT

   2250     .    :    .    :    .    :    .    :    .    :
   2080 GCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACA        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  76230 GCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGTA...CA

   2300     .    :    .    :    .    :    .    :    .    :
   2122  GGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  77688 GGGTGTCCACCCAATTGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACA

   2350     .    :    .    :    .    :    .    :    .    :
   2171 ATGGCTTCCATG         CAATTGGGCAGATGTGTGAGGCACCTGTG
        ||||||||||||>>>...>>>|||||||||||||||||||||||||||||
  77738 ATGGCTTCCATGGTA...CAGCAATTGGGCAGATGTGTGAGGCACCTGTG

   2400     .    :    .    :    .    :    .    :    .    :
   2212 GTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79619 GTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGA

   2450     .    :    .    :    .    :    .    :    .    :
   2262 GCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79669 GCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGC

   2500     .    :    .    :    .    :    .    :    .    :
   2312 AGCCAGCCACAGGTACAGAGCCACAGGACCC AAGAATGAGCTTACAAAG
        |||||||||||||||||||||||||||||||-||||||||||||||||||
  79719 AGCCAGCCACAGGTACAGAGCCACAGGACCCCAAGAATGAGCTTACAAAG

   2550     .    :    .    :    .    :    .    :    .    :
   2361 TGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79769 TGGCCTTTCCAGGCCCTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTG

   2600     .    :    .    :    .    :    .    :    .    :
   2411 TCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79819 TCCTGGCTACTAAATATTTTATGTACATCAGCCTGAAAAGGACTTCTGGC

   2650     .    :    .    :    .    :    .    :    .    :
   2461 TATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79869 TATGCAAGGGTCCCTTAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATC

   2700     .    :    .    :    .    :    .    :    .    :
   2511 TGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79919 TGCCATGAGCACAAAATTATGGTAATTTTTCACCTGAGAAGATTTTAAAA

   2750     .    :    .    :    .    :    .    :    .    :
   2561 CCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79969 CCATTTAAACGCCACCAATTGAGCAAGATGCTGATTCATTATTTATCAGC

   2800     .    :    .    :    .    :    .    :    .    :
   2611 CCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80019 CCTATTCTTTCTATTCAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAG

   2850     .    :    .    :    .    :    .    :    .    :
   2661 TGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80069 TGGCTTGGCCTCAAGAGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAA

   2900     .    :    .    :    .    :    .    :    .    :
   2711 ACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80119 ACCCTGTGTTCACAAAGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGT

   2950     .    :    .    :    .    :    .    :    .    :
   2761 GCTTGGGATCGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80169 GCTTGGGATCGATTATGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTC

   3000     .    :    .    :    .    :    .    :    .    :
   2811 TCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80219 TCAAATGTTGGAGTGGAACATTGGGGAGGAAATTCTGAGGCAGGTATTAG

   3050     .    :    .    :    .    :    .    :    .    :
   2861 AAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80269 AAATGAAAAGGAAACTTGAAACCTGGGCATGGTGGCTCACGCCTGTAATC

   3100     .    :    .    :    .    :    .    :    .    :
   2911 CCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80319 CCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTC

   3150     .    :    .    :    .    :    .    :    .    :
   2961 GAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80369 GAAACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAG

   3200     .    :    .    :    .    :    .    :    .    :
   3011 AAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80419 AAATTAGCCGGTCATGGTGGTGGACACCTGTAATCCCAGCTACTCAGGTG

   3250     .    :    .    :    .    :    .    :    .    :
   3061 GCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80469 GCTAAGGCAGGAGAATCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGC

   3300     .    :    .    :    .    :    .    :    .    :
   3111 CAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80519 CAAGATCATACCACGGCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTC

   3350     .    :    .    :    .    :    .    :    .    :
   3161 AAAAAAAAAAAAAAAAAA GGAAAATGAAACTAGGAAAGGTTTCTTAAAG
        ||||||||||||||||||-||||||||||||||| | || ||||| ||||
  80569 AAAAAAAAAAAAAAAAAAAGGAAAATGAAACTAGAAGAGATTTCTAAAAG

   3400     .    :    .    :    .    :    .    :    .    :
   3210 TCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80619 TCTGAGATATATTTGCTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGA

   3450     .    :    .    :    .    :    .    :    .    :
   3260 AGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80669 AGATTTTCAAGAACCGGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGT

   3500     .    :    .    :    .    :    .    :    .    :
   3310 AATAAGTAAAATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80719 AATAAGTAAAATGTTTATTGTTGTAGCTCTGGTATATAATCCATTCCTCT

   3550     .    :    .    :    .    :    .    :    .    :
   3360 TAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80769 TAAAATATAAGACCTCTGGCATGAATATTTCATATCTATAAAATGACAGA

   3600     .    :    .    :    .    :    .    :    .    :
   3410 TCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80819 TCCCACCAGGAAGGAAGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTT

   3650     .    :    .    :    .    :    .    :    .    :
   3460 GCTCCCTGTTGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80869 GCTCCCTGTTGCTGAAACCATACAGCTTCATAAATAATTTTGCTTGCTGA

   3700     .    :    .    :    .    :    .    :    .    :
   3510 AGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80919 AGGAAGAAAAAGTGTTTTTCATAAACCCATTATCCAGGACTGTTTATAGC

   3750     .    :    .    :    .    :    .    :    .    :
   3560 TGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80969 TGTTGGAAGGACTAGGTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTG

   3800     .    :    .    :    .    :    .    :    .    :
   3610 AAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81019 AAGACTTGATTGTACAAAATACGTTTTGTAAATGTTGTGCTGTTAACACT

   3850     .    :    .    :
   3660 GCAAATAAACTTGGTAGCAAACA
        |||||||||||||||||||||||
  81069 GCAAATAAACTTGGTAGCAAACA

END