Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_007305.1
Subject Sequence ID: ENSG00000012048
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_00/NM_007305.1, 3676 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000012048 (ENSG00000012048), 81091 bp

>gi|6552320|ref|NM_007305.1| Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta9-10-11b, mRNA
>ENSG00000012048

(complement)

1-122  (1-121)   95% ->
123-221  (1277-1375)   100% ->
222-275  (9613-9666)   100% ->
276-353  (18859-18936)   100% ->
354-442  (20436-20524)   100% ->
443-582  (21131-21270)   100% ->
583-688  (25512-25617)   100% ->
689-805  (30532-30648)   100% ->
806-894  (34360-34448)   100% ->
895-1066  (42817-42988)   100% ->
1067-1193  (48778-48904)   100% ->
1194-1384  (50871-51061)   100% ->
1385-1695  (54154-54464)   100% ->
1696-1783  (57697-57784)   100% ->
1784-1861  (61441-61518)   100% ->
1862-1902  (62019-62059)   100% ->
1903-1986  (68257-68340)   100% ->
1987-2041  (74275-74329)   100% ->
2042-2115  (76198-76271)   100% ->
2116-2176  (77689-77749)   100% ->
2177-3676  (79590-81091)   99%

      0     .    :    .    :    .    :    .    :    .    :
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCA
        ||||||||||||||||||||||||||||||||||||||||||||   | |
      1 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACGGGGGA

     50     .    :    .    :    .    :    .    :    .    :
     51 CCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT
        |-||||||||||||||||||||||||||||||||||||||||||||||||
     51 C AGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCT

    100     .    :    .    :    .    :    .    :    .    :
    101 TCACCCTCTGCTCTGGGTAAAG         TTCATTGGAACAGAAAGAA
        ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
    100 TCACCCTCTGCTCTGGGTAAAGGTA...AAGTTCATTGGAACAGAAAGAA

    150     .    :    .    :    .    :    .    :    .    :
    142 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   1296 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGC

    200     .    :    .    :    .    :    .    :    .    :
    192 TATGCAGAAAATCTTAGAGTGTCCCATCTG         TCTGGAGTTGA
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
   1346 TATGCAGAAAATCTTAGAGTGTCCCATCTGGTA...TAGTCTGGAGTTGA

    250     .    :    .    :    .    :    .    :    .    :
    233 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAA       
        |||||||||||||||||||||||||||||||||||||||||||>>>...>
   9624 TCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAGTA...T

    300     .    :    .    :    .    :    .    :    .    :
    276   ATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG
        >>||||||||||||||||||||||||||||||||||||||||||||||||
  18857 AGATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTG

    350     .    :    .    :    .    :    .    :    .    :
    324 TCCTTTATGTAAGAATGATATAACCAAAAG         GAGCCTACAAG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  18907 TCCTTTATGTAAGAATGATATAACCAAAAGGTA...CAGGAGCCTACAAG

    400     .    :    .    :    .    :    .    :    .    :
    365 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  20447 AAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGT

    450     .    :    .    :    .    :    .    :    .    :
    415 GCTTTTCAGCTTGACACAGGTTTGGAGT         ATGCAAACAGCTA
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
  20497 GCTTTTCAGCTTGACACAGGTTTGGAGTGTA...CAGATGCAAACAGCTA

    500     .    :    .    :    .    :    .    :    .    :
    456 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21144 TAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAG

    550     .    :    .    :    .    :    .    :    .    :
    506 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  21194 TTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTA

    600     .    :    .    :    .    :    .    :    .    :
    556 CAGAGTGAACCCGAAAATCCTTCCTTG         CAGGAAACCAGTCT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  21244 CAGAGTGAACCCGAAAATCCTTCCTTGGTA...TAGCAGGAAACCAGTCT

    650     .    :    .    :    .    :    .    :    .    :
    597 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  25526 CAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGC

    700     .    :    .    :    .    :    .    :    .    :
    647 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGG        
        ||||||||||||||||||||||||||||||||||||||||||>>>...>>
  25576 AGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGTA...CA

    750     .    :    .    :    .    :    .    :    .    :
    689  CTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCA
        >|||||||||||||||||||||||||||||||||||||||||||||||||
  30531 GCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCA

    800     .    :    .    :    .    :    .    :    .    :
    738 ACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  30581 ACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGC

    850     .    :    .    :    .    :    .    :    .    :
    788 ATCCAGAAAAGTATCAGG         GTGAAGCAGCATCTGGGTGTGAG
        ||||||||||||||||||>>>...>>>|||||||||||||||||||||||
  30631 ATCCAGAAAAGTATCAGGGTA...AAGGTGAAGCAGCATCTGGGTGTGAG

    900     .    :    .    :    .    :    .    :    .    :
    829 AGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  34383 AGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGA

    950     .    :    .    :    .    :    .    :    .    :
    879 CATTTTAACCACTCAG         CAGAGGGATACCATGCAACATAACC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
  34433 CATTTTAACCACTCAGGTA...AAGCAGAGGGATACCATGCAACATAACC

   1000     .    :    .    :    .    :    .    :    .    :
    920 TGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42842 TGATAAAGCTCCAGCAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAG

   1050     .    :    .    :    .    :    .    :    .    :
    970 CATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  42892 CATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTC

   1100     .    :    .    :    .    :    .    :    .    :
   1020 TGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
  42942 TGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGGTG

   1150     .    :    .    :    .    :    .    :    .    :
   1067       CAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAG
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  42992 ...AAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAG

   1200     .    :    .    :    .    :    .    :    .    :
   1111 AATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  48822 AATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTC

   1250     .    :    .    :    .    :    .    :    .    :
   1161 TACCAGTAAAAATAAAGAACCAGGAGTGGAAAG         GTCATCCC
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  48872 TACCAGTAAAAATAAAGAACCAGGAGTGGAAAGGTA...TAGGTCATCCC

   1300     .    :    .    :    .    :    .    :    .    :
   1202 CTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50879 CTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCT

   1350     .    :    .    :    .    :    .    :    .    :
   1252 GGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50929 GGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGT

   1400     .    :    .    :    .    :    .    :    .    :
   1302 TGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  50979 TGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGA

   1450     .    :    .    :    .    :    .    :    .    :
   1352 CGGAAACATCTTACTTGCCAAGGCAAGATCTAG         AGGGAACC
        |||||||||||||||||||||||||||||||||>>>...>>>||||||||
  51029 CGGAAACATCTTACTTGCCAAGGCAAGATCTAGGTA...CAGAGGGAACC

   1500     .    :    .    :    .    :    .    :    .    :
   1393 CCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54162 CCTTACCTGGAATCTGGAATCAGCCTCTTCTCTGATGACCCTGAATCTGA

   1550     .    :    .    :    .    :    .    :    .    :
   1443 TCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54212 TCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCAT

   1600     .    :    .    :    .    :    .    :    .    :
   1493 CTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54262 CTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAATCTGCC

   1650     .    :    .    :    .    :    .    :    .    :
   1543 CAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54312 CAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAAT

   1700     .    :    .    :    .    :    .    :    .    :
   1593 GGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54362 GGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAA

   1750     .    :    .    :    .    :    .    :    .    :
   1643 GGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  54412 GGGTCAACAAAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAA

   1800     .    :    .    :    .    :    .    :    .    :
   1693 TTT         ATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCAC
        |||>>>...>>>||||||||||||||||||||||||||||||||||||||
  54462 TTTGTG...CAGATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCAC

   1850     .    :    .    :    .    :    .    :    .    :
   1734 TTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  57735 TTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAG

   1900     .    :    .    :    .    :    .    :    .    :
   1784          ATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTA
        >>>...>>>|||||||||||||||||||||||||||||||||||||||||
  57785 GTA...CAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTA

   1950     .    :    .    :    .    :    .    :    .    :
   1825 GGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCT         GGGT
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
  61482 GGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGTA...TAGGGGT

   2000     .    :    .    :    .    :    .    :    .    :
   1866 GACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAG         CATG
        |||||||||||||||||||||||||||||||||||||>>>...>>>||||
  62023 GACCCAGTCTATTAAAGAAAGAAAAATGCTGAATGAGGTA...CAGCATG

   2050     .    :    .    :    .    :    .    :    .    :
   1907 ATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  68261 ATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCA

   2100     .    :    .    :    .    :    .    :    .    :
   1957 AAGCGAGCAAGAGAATCCCAGGACAGAAAG         ATCTTCAGGGG
        ||||||||||||||||||||||||||||||>>>...>>>|||||||||||
  68311 AAGCGAGCAAGAGAATCCCAGGACAGAAAGGTA...CAGATCTTCAGGGG

   2150     .    :    .    :    .    :    .    :    .    :
   1998 GCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAG      
        ||||||||||||||||||||||||||||||||||||||||||||>>>...
  74286 GCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGGTA...

   2200     .    :    .    :    .    :    .    :    .    :
   2042    ATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAG
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
  76195 TAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAG

   2250     .    :    .    :    .    :    .    :    .    :
   2089 GAGCTTTCATCATTCACCCTTGGCACA         GGTGTCCACCCAAT
        |||||||||||||||||||||||||||>>>...>>>||||||||||||||
  76245 GAGCTTTCATCATTCACCCTTGGCACAGTA...CAGGGTGTCCACCCAAT

   2300     .    :    .    :    .    :    .    :    .    :
   2130 TGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATG   
        |||||||||||||||||||||||||||||||||||||||||||||||>>>
  77703 TGTGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGGTA

   2350     .    :    .    :    .    :    .    :    .    :
   2177       CAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGG
        ...>>>||||||||||||||||||||||||||||||||||||||||||||
  77753 ...CAGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGG

   2400     .    :    .    :    .    :    .    :    .    :
   2221 GTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79634 GTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCT

   2450     .    :    .    :    .    :    .    :    .    :
   2271 GATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAGCCACAGGTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79684 GATACCCCAGATCCCCCACAGCCACTACTGACTGCAGCCAGCCACAGGTA

   2500     .    :    .    :    .    :    .    :    .    :
   2321 CAGAGCCAC GGACCCCAAGAATGAGCTTACAAAGTGGCCTTTCCAGGCC
        |||||||||-||||||||||||||||||||||||||||||||||||||||
  79734 CAGAGCCACAGGACCCCAAGAATGAGCTTACAAAGTGGCCTTTCCAGGCC

   2550     .    :    .    :    .    :    .    :    .    :
   2370 CTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGGCTACTAAAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79784 CTGGGAGCTCCTCTCACTCTTCAGTCCTTCTACTGTCCTGGCTACTAAAT

   2600     .    :    .    :    .    :    .    :    .    :
   2420 ATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCAAGGGTCCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79834 ATTTTATGTACATCAGCCTGAAAAGGACTTCTGGCTATGCAAGGGTCCCT

   2650     .    :    .    :    .    :    .    :    .    :
   2470 TAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCATGAGCACAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79884 TAAAGATTTTCTGCTTGAAGTCTCCCTTGGAAATCTGCCATGAGCACAAA

   2700     .    :    .    :    .    :    .    :    .    :
   2520 ATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTTAAACGCCAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79934 ATTATGGTAATTTTTCACCTGAGAAGATTTTAAAACCATTTAAACGCCAC

   2750     .    :    .    :    .    :    .    :    .    :
   2570 CAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATTCTTTCTATT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  79984 CAATTGAGCAAGATGCTGATTCATTATTTATCAGCCCTATTCTTTCTATT

   2800     .    :    .    :    .    :    .    :    .    :
   2620 CAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGCCTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80034 CAGGCTGTTGTTGGCTTAGGGCTGGAAGCACAGAGTGGCTTGGCCTCAAG

   2850     .    :    .    :    .    :    .    :    .    :
   2670 AGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGTTCACAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80084 AGAATAGCTGGTTTCCCTAAGTTTACTTCTCTAAAACCCTGTGTTCACAA

   2900     .    :    .    :    .    :    .    :    .    :
   2720 AGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGATCGATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80134 AGGCAGAGAGTCAGACCCTTCAATGGAAGGAGAGTGCTTGGGATCGATTA

   2950     .    :    .    :    .    :    .    :    .    :
   2770 TGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTTGGAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80184 TGTGACTTAAAGTCAGAATAGTCCTTGGGCAGTTCTCAAATGTTGGAGTG

   3000     .    :    .    :    .    :    .    :    .    :
   2820 GAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAAGGAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80234 GAACATTGGGGAGGAAATTCTGAGGCAGGTATTAGAAATGAAAAGGAAAC

   3050     .    :    .    :    .    :    .    :    .    :
   2870 TTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80284 TTGAAACCTGGGCATGGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAG

   3100     .    :    .    :    .    :    .    :    .    :
   2920 GCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGCCTGGCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80334 GCCAAGGTGGGCAGATCACTGGAGGTCAGGAGTTCGAAACCAGCCTGGCC

   3150     .    :    .    :    .    :    .    :    .    :
   2970 AACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCCGGTCAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80384 AACATGGTGAAACCCCATCTCTACTAAAAATACAGAAATTAGCCGGTCAT

   3200     .    :    .    :    .    :    .    :    .    :
   3020 GGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCAGGAGAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80434 GGTGGTGGACACCTGTAATCCCAGCTACTCAGGTGGCTAAGGCAGGAGAA

   3250     .    :    .    :    .    :    .    :    .    :
   3070 TCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80484 TCACTTCAGCCCGGGAGGTGGAGGTTGCAGTGAGCCAAGATCATACCACG

   3300     .    :    .    :    .    :    .    :    .    :
   3120 GCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80534 GCACTCCAGCCTGGGTGACAGTGAGACTGTGGCTCAAAAAAAAAAAAAAA

   3350     .    :    .    :    .    :    .    :    .    :
   3170 AAA GGAAAATGAAACTAGGAAAGGTTTCTTAAAGTCTGAGATATATTTG
        |||-||||||||||||||| | || ||||| |||||||||||||||||||
  80584 AAAAGGAAAATGAAACTAGAAGAGATTTCTAAAAGTCTGAGATATATTTG

   3400     .    :    .    :    .    :    .    :    .    :
   3219 CTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80634 CTAGATTTCTAAAGAATGTGTTCTAAAACAGCAGAAGATTTTCAAGAACC

   3450     .    :    .    :    .    :    .    :    .    :
   3269 GGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80684 GGTTTCCAAAGACAGTCTTCTAATTCCTCATTAGTAATAAGTAAAATGTT

   3500     .    :    .    :    .    :    .    :    .    :
   3319 TATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80734 TATTGTTGTAGCTCTGGTATATAATCCATTCCTCTTAAAATATAAGACCT

   3550     .    :    .    :    .    :    .    :    .    :
   3369 CTGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80784 CTGGCATGAATATTTCATATCTATAAAATGACAGATCCCACCAGGAAGGA

   3600     .    :    .    :    .    :    .    :    .    :
   3419 AGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80834 AGCTGTTGCTTTCTTTGAGGTGATTTTTTTCCTTTGCTCCCTGTTGCTGA

   3650     .    :    .    :    .    :    .    :    .    :
   3469 AACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80884 AACCATACAGCTTCATAAATAATTTTGCTTGCTGAAGGAAGAAAAAGTGT

   3700     .    :    .    :    .    :    .    :    .    :
   3519 TTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80934 TTTTCATAAACCCATTATCCAGGACTGTTTATAGCTGTTGGAAGGACTAG

   3750     .    :    .    :    .    :    .    :    .    :
   3569 GTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATTGTAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  80984 GTCTTCCCTAGCCCCCCCAGTGTGCAAGGGCAGTGAAGACTTGATTGTAC

   3800     .    :    .    :    .    :    .    :    .    :
   3619 AAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAATAAACTTGGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  81034 AAAATACGTTTTGTAAATGTTGTGCTGTTAACACTGCAAATAAACTTGGT

   3850     .
   3669 AGCAAACA
        ||||||||
  81084 AGCAAACA

END