Show SIM4 / tBLASTn alignment result

PARAMETERS:
Query Sequence ID: NM_152854.1
Subject Sequence ID: ENSG00000101017
Subject Sequence type: 2


seq1 = /RAID/mart2/Splice/public_html/fasta/rna.fa/NM_15/NM_152854.1, 1115 bp
seq2 = /RAID/mart2/Splice/web_temp/fasta/ENSG00000101017 (ENSG00000101017), 11025 bp

>gi|23312370|ref|NM_152854.1| Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), transcript variant 2, mRNA
>ENSG00000101017

1-128  (1-128)   100% ->
129-207  (3554-3632)   100% ->
208-333  (3967-4092)   100% ->
334-480  (4344-4490)   100% ->
481-574  (4860-4953)   100% ->
575-661  (9872-9958)   100% ->
662-690  (10064-10092)   100% ->
691-1100  (10616-11025)   100%

      0     .    :    .    :    .    :    .    :    .    :
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
      1 GCCAAGGCTGGGGCAGGGGAGTCAGCAGAGGCCTCGCTCGGGCGCCCAGT

     50     .    :    .    :    .    :    .    :    .    :
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
     51 GGTCCTGCCGCCTGGTCTCACCTCGCTATGGTTCGTCTGCCTCTGCAGTG

    100     .    :    .    :    .    :    .    :    .    :
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCT         GTCCATCCAGAAC
        ||||||||||||||||||||||||||||>>>...>>>|||||||||||||
    101 CGTCCTCTGGGGCTGCTTGCTGACCGCTGTG...TAGGTCCATCCAGAAC

    150     .    :    .    :    .    :    .    :    .    :
    142 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3567 CACCCACTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGT

    200     .    :    .    :    .    :    .    :    .    :
    192 TCTTTGTGCCAGCCAG         GACAGAAACTGGTGAGTGACTGCAC
        ||||||||||||||||>>>...>>>|||||||||||||||||||||||||
   3617 TCTTTGTGCCAGCCAGGTG...CAGGACAGAAACTGGTGAGTGACTGCAC

    250     .    :    .    :    .    :    .    :    .    :
    233 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   3992 AGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAG

    300     .    :    .    :    .    :    .    :    .    :
    283 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4042 ACACCTGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCC

    350     .    :    .    :    .    :    .    :    .    :
    333 A         ACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC
        |>>>...>>>||||||||||||||||||||||||||||||||||||||||
   4092 AGTG...CAGACCTAGGGCTTCGGGTCCAGCAGAAGGGCACCTCAGAAAC

    400     .    :    .    :    .    :    .    :    .    :
    374 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4384 AGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCT

    450     .    :    .    :    .    :    .    :    .    :
    424 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4434 GTGAGAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAG

    500     .    :    .    :    .    :    .    :    .    :
    474 CAGATTG         CTACAGGGGTTTCTGATACCATCTGCGAGCCCTG
        |||||||>>>...>>>||||||||||||||||||||||||||||||||||
   4484 CAGATTGGTA...CAGCTACAGGGGTTTCTGATACCATCTGCGAGCCCTG

    550     .    :    .    :    .    :    .    :    .    :
    515 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   4894 CCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACC

    600     .    :    .    :    .    :    .    :    .    :
    565 CTTGGACAAG         GTCCCCAGGATCGGCTGAGAGCCCTGGTGGT
        ||||||||||>>>...>>>|||||||||||||||||||||||||||||||
   4944 CTTGGACAAGGTA...CAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGT

    650     .    :    .    :    .    :    .    :    .    :
    606 GATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
   9903 GATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCT

    700     .    :    .    :    .    :    .    :    .    :
    656 TTATCA         AAAAGGTGGCCAAGAAGCCAACCAATAAG      
        ||||||>>>...>>>|||||||||||||||||||||||||||||>>>...
   9953 TTATCAGTG...TAGAAAAGGTGGCCAAGAAGCCAACCAATAAGGTA...

    750     .    :    .    :    .    :    .    :    .    :
    691    GCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGA
        >>>|||||||||||||||||||||||||||||||||||||||||||||||
  10613 CAGGCCCCCCACCCCAAGCAGGAACCCCAGGAGATCAATTTTCCCGACGA

    800     .    :    .    :    .    :    .    :    .    :
    738 TCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGAT
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10663 TCTTCCTGGCTCCAACACTGCTGCTCCAGTGCAGGAGACTTTACATGGAT

    850     .    :    .    :    .    :    .    :    .    :
    788 GCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10713 GCCAACCGGTCACCCAGGAGGATGGCAAAGAGAGTCGCATCTCAGTGCAG

    900     .    :    .    :    .    :    .    :    .    :
    838 GAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAAC
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10763 GAGAGACAGTGAGGCTGCACCCACCCAGGAGTGTGGCCACGTGGGCAAAC

    950     .    :    .    :    .    :    .    :    .    :
    888 AGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10813 AGGCAGTTGGCCAGAGAGCCTGGTGCTGCTGCTGCTGTGGCGTGAGGGTG

   1000     .    :    .    :    .    :    .    :    .    :
    938 AGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCTGCACCCCTG
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10863 AGGGGCTGGCACTGACTGGGCATAGCTCCCCGCTTCTGCCTGCACCCCTG

   1050     .    :    .    :    .    :    .    :    .    :
    988 CAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTGA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10913 CAGTTTGAGACAGGAGACCTGGCACTGGATGCAGAAACAGTTCACCTTGA

   1100     .    :    .    :    .    :    .    :    .    :
   1038 AGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTTGTATTA
        ||||||||||||||||||||||||||||||||||||||||||||||||||
  10963 AGAACCTCTCACTTCACCCTGGAGCCCATCCAGTCTCCCAACTTGTATTA

   1150     .    :
   1088 AAGACAGAGGCAG
        |||||||||||||
  11013 AAGACAGAGGCAG

END